DNASU Plasmid Repository • 480.965.5697 | Email

ADCY5 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ADCY5
Gene Name:  adenylate cyclase 5
Sequence             
Original Clone ID: FLH269678.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00082897

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3783nts         Open reading frame : 1 to 3783
Reference Sequence Alignment

ATGTCCGGCTCCAAAAGCGTGAGCCCCCCGGGCTACGCGGCGCAGAAGACTGCGGCGCCG
GCGCCCCGGGGAGGCCCCGAACACCGCTCTGCGTGGGGCGAGGCCGATTCCCGCGCGAAT
GGCTACCCCCATGCCCCCGGGGGCTCTGCCCGCGGCTCCACCAAGAAACCCGGGGGGGCG
GTGACCCCGCAGCAGCAGCAGCGCCTGGCCAGCCGCTGGCGCAGCGACGACGACGACGAT
CCTCCGCTGAGCGGTGACGACCCCCTGGCCGGGGGCTTCGGCTTCAGCTTCCGCTCCAAG
TCCGCCTGGCAGGAGCGCGGCGGCGACGACTGCGGTCGCGGCAGCCGCCGGCAGCGGCGG
GGCGCGGCCAGCGGGGGCAGCACCCGGGCGCCCCCTGCGGGCGGCGGCGGCGGCTCGGCG
GCGGCGGCTGCCTCGGCGGGCGGGACGGAGGTGCGCCCTCGCTCGGTGGAGGTGGGTCTG
GAGGAGCGGCGGGGCAAGGGGCGCGCGGCCGACGAGCTGGAGGCCGGCGCCGTCGAGGGC
GGCGAGGGGTCCGGGGATGGCGGCAGCTCGGCGGACTCGGGCTCGGGCGCGGGGCCCGGC
GCGGTGCTGTCCCTGGGCGCCTGCTGCCTGGCGTTGCTGCAGATATTCCGCTCCAAGAAG
TTCCCGTCGGACAAACTGGAGCGGCTGTACCAGCGCTACTTCTTCCGCCTGAACCAGAGC
AGCCTCACCATGCTCATGGCCGTGCTGGTGCTCGTGTGCCTGGTCATGTTGGCCTTCCAC
GCGGCGCGGCCCCCGCTCCAGCTGCCCTACCTGGCCGTGCTGGCGGCCGCCGTCGGCGTG
ATCCTCATCATGGCTGTGCTTTGCAACCGCGCCGCCTTCCACCAGGACCACATGGGCCTG
GCCTGCTATGCGCTCATCGCCGTGGTGCTGGCCGTCCAGGTGGTGGGCCTGCTGCTGCCG
CAGCCACGCAGCGCCTCTGAGGGCATCTGGTGGACCGTGTTCTTCATCTACACCATCTAC
ACGCTGCTGCCCGTGCGCATGCGGGCCGCAGTGCTCAGCGGGGTGCTCCTGTCCGCCCTC
CACCTGGCCATCGCCCTGCGCACCAACGCCCAGGACCAGTTCCTGCTGAAGCAGCTTGTC
TCCAATGTTCTCATTTTCTCCTGCACCAACATCGTGGGTGTCTGCACCCACTATCCGGCT
GAGGTCTCCCAGAGACAGGCTTTCCAGGAGACCCGAGAGTGCATCCAGGCGCGGCTCCAC
TCGCAGCGGGAGAACCAGCAGCAGGAACGGCTCCTGCTGTCTGTCCTTCCCCGTCATGTT
GCCATGGAGATGAAAGCAGACATCAACGCCAAGCAGGAGGATATGATGTTCCATAAGATT
TACATCCAGAAACATGACAACGTGAGCATCCTGTTTGCTGACATCGAGGGCTTCACCAGC
CTGGCGTCCCAGTGCACTGCACAGGAACTGGTCATGACCCTCAACGAGCTCTTCGCCCGC
TTTGACAAGCTGGCCGCAGAGAATCACTGTTTACGTATTAAGATCCTTGGGGATTGTTAT
TACTGCGTCTCGGGGCTGCCTGAAGCAAGGGCTGACCACGCCCACTGCTGTGTGGAGATG
GGCATGGACATGATCGAGGCCATCTCGTTGGTCCGGGAGGTGACAGGGGTGAACGTGAAC
ATGCGTGTGGGAATTCACAGCGGGCGAGTACACTGCGGTGTCCTTGGTCTCAGGAAGTGG
CAGTTCGACGTCTGGTCTAACGATGTCACGCTAGCCAACCACATGGAGGCTGGCGGCAAG
GCAGGACGCATCCACATCACCAAGGCTACACTCAACTACCTGAATGGGGACTACGAGGTG
GAGCCAGGCTGTGGGGGCGAGCGCAACGCCTACCTCAAGGAGCACAGTATCGAGACCTTC
CTCATCCTGCGCTGCACCCAGAAGCGGAAAGAAGAGAAGGCCATGATCGCCAAGATGAAC
CGCCAGAGAACCAACTCCATCGGGCACAACCCACCACACTGGGGGGCTGAGCGCCCCTTC
TACAACCACCTGGGTGGCAACCAGGTGTCCAAGGAGATGAAGCGGATGGGCTTTGAAGAC
CCCAAGGACAAGAACGCCCAGGAGAGTGCGAACCCTGAGGATGAAGTGGATGAGTTTCTG
GGCCGTGCCATTGACGCCAGGAGCATTGATAGGCTTCGGTCTGAGCACGTCCGCAAGTTC
CTCCTGACCTTCAGGGAGCCTGACTTAGAGAAGAAGTACTCCAAGCAGGTAGACGACCGA
TTTGGTGCCTATGTGGCGTGTGCCTCGCTCGTCTTCCTCTTCATCTGCTTTGTCCAGATC
ACCATCGTGCCCCACTCCATATTCATGCTCAGCTTCTACCTGACCTGTTCCCTGCTGCTG
ACCTTGGTGGTGTTTGTGTCTGTGATCTACTCCTGCGTAAAGCTCTTCCCCTCCCCACTG
CAGACCCTCTCCAGGAAGATCGTGCGGTCCAAGATGAACAGCACCCTGGTTGGGGTGTTC
ACCATCACCCTGGTGTTCCTGGCGGCTTTTGTCAACATGTTCACGTGCAACTCCAGGGAC
CTGCTGGGCTGCTTGGCACAGGAGCACAACATCAGCGCGAGCCAGGTCAACGCGTGTCAC
GTGGCGGAGTCGGCCGTCAACTACAGCCTGGGCGATGAGCAGGGCTTCTGTGGCAGCCCC
TGGCCCAACTGCAACTTCCCCGAGTACTTCACCTACAGCGTGCTGCTCAGCCTGCTGGCC
TGCTCCGTGTTCCTGCAGATCAGCTGCATCGGGAAGCTGGTGCTCATGCTGGCCATCGAG
CTCATCTACGTGCTCATCGTGGAGGTGCCAGGTGTCACGCTCTTCGACAACGCCGACCTG
CTGGTCACCGCCAACGCCATAGACTTCTTCAACAACGGGACCTCCCAGTGCCCTGAGCAT
GCAACCAAGGTGGCATTGAAGGTGGTGACGCCCATCATCATCTCAGTCTTTGTGCTGGCC
CTGTACCTGCACGCCCAGCAGGTGGAGTCCACTGCCCGCCTCGACTTCCTCTGGAAACTG
CAGGCCACAGAGGAGAAAGAGGAGATGGAGGAGCTGCAGGCCTACAACCGGCGGCTGCTG
CACAACATCCTGCCCAAGGACGTGGCCGCTCACTTCCTGGCCCGCGAGCGGCGCAATGAT
GAGCTCTACTATCAGTCCTGTGAGTGTGTGGCGGTCATGTTCGCCTCCATCGCCAACTTC
TCCGAGTTCTACGTTGAGCTGGAGGCCAACAACGAGGGTGTCGAGTGCCTGCGGCTACTC
AATGAGATCATCGCTGACTTTGATGAGATCATCAGCGAGGATCGGTTCCGGCAGCTGGAG
AAGATCAAGACCATCGGCAGCACCTACATGGCTGCCTCCGGCCTCAACGACTCTACCTAC
GACAAGGTGGGCAAGACCCACATCAAGGCACTGGCCGACTTTGCCATGAAGCTGATGGAC
CAGATGAAGTACATCAATGAGCACTCCTTCAACAACTTCCAGATGAAGATCGGGCTCAAC
ATCGGCCCCGTGGTGGCCGGGGTGATAGGGGCACGAAAGCCTCAGTACGACATCTGGGGC
AATACCGTGAACGTGGCCAGCCGCATGGACAGCACCGGTGTACCCGACCGCATCCAGGTC
ACCACAGACATGTACCAGGTGCTGGCTGCCAACACGTACCAGCTGGAGTGCCGGGGCGTG
GTCAAGGTCAAGGGCAAAGGCGAGATGATGACCTACTTCCTCAATGGAGGGCCCCCGCTC
AGT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3786
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TCAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ADCY5
Symbol Nomenclature : ADCY5
SYNONYM : AC5; FDFM
Designation : ATP pyrophosphate-lyase 5|adenylate cyclase type 5|adenylate cyclase type V|adenylyl cyclase 5
Full Nomenclature : adenylate cyclase 5
GENEID : 111
GI : 162317615
GenBank Accession : BC156217
HGNC : 236
MIM : 600293
Vega : OTTHUMG00000159517
Target GenBank: NM_183357

 

Reference Sequence Alignment

  

HsCD00082897        ATGTCCGGCTCCAAAAGCGTGAGCCCCCCGGGCTACGCGGCGCAGAAGACTGCGGCGCCG
NM_183357.2         ATGTCCGGCTCCAAAAGCGTGAGCCCCCCGGGCTACGCGGCGCAGAAGACTGCGGCGCCG
XM_005247077.1      ATGTCCGGCTCCAAAAGCGTGAGCCCCCCGGGCTACGCGGCGCAGAAGACTGCGGCGCCG
                    ************************************************************

HsCD00082897        GCGCCCCGGGGAGGCCCCGAACACCGCTCTGCGTGGGGCGAGGCCGATTCCCGCGCGAAT
NM_183357.2         GCGCCCCGGGGAGGCCCCGAACACCGCTCTGCGTGGGGCGAGGCCGATTCCCGCGCGAAT
XM_005247077.1      GCGCCCCGGGGAGGCCCCGAACACCGCTCTGCGTGGGGCGAGGCCGATTCCCGCGCGAAT
                    ************************************************************

HsCD00082897        GGCTACCCCCATGCCCCCGGGGGCTCTGCCCGCGGCTCCACCAAGAAACCCGGGGGGGCG
NM_183357.2         GGCTACCCCCATGCCCCCGGGGGCTCTGCCCGCGGCTCCACCAAGAAACCCGGGGGGGCG
XM_005247077.1      GGCTACCCCCATGCCCCCGGGGGCTCTGCCCGCGGCTCCACCAAGAAACCCGGGGGGGCG
                    ************************************************************

HsCD00082897        GTGACCCCGCAGCAGCAGCAGCGCCTGGCCAGCCGCTGGCGCAGCGACGACGACGACGAT
NM_183357.2         GTGACCCCGCAGCAGCAGCAGCGCCTGGCCAGCCGCTGGCGCAGCGACGACGACGACGAT
XM_005247077.1      GTGACCCCGCAGCAGCAGCAGCGCCTGGCCAGCCGCTGGCGCAGCGACGACGACGACGAT
                    ************************************************************

HsCD00082897        CCTCCGCTGAGCGGTGACGACCCCCTGGCCGGGGGCTTCGGCTTCAGCTTCCGCTCCAAG
NM_183357.2         CCTCCGCTGAGCGGTGACGACCCCCTGGCCGGGGGCTTCGGCTTCAGCTTCCGCTCCAAG
XM_005247077.1      CCTCCGCTGAGCGGTGACGACCCCCTGGCCGGGGGCTTCGGCTTCAGCTTCCGCTCCAAG
                    ************************************************************

HsCD00082897        TCCGCCTGGCAGGAGCGCGGCGGCGACGACTGCGGTCGCGGCAGCCGCCGGCAGCGGCGG
NM_183357.2         TCCGCCTGGCAGGAGCGCGGCGGCGACGACTGCGGTCGCGGCAGCCGCCGGCAGCGGCGG
XM_005247077.1      TCCGCCTGGCAGGAGCGCGGCGGCGACGACTGCGGTCGCGGCAGCCGCCGGCAGCGGCGG
                    ************************************************************

HsCD00082897        GGCGCGGCCAGCGGGGGCAGCACCCGGGCGCCCCCTGCGGGCGGCGGCGGCGGCTCGGCG
NM_183357.2         GGCGCGGCCAGCGGGGGCAGCACCCGGGCGCCCCCTGCGGGCGGCGGCGGCGGCTCGGCG
XM_005247077.1      GGCGCGGCCAGCGGGGGCAGCACCCGGGCGCCCCCTGCGGGCGGCGGCGGCGGCTCGGCG
                    ************************************************************

HsCD00082897        GCGGCGGCTGCCTCGGCGGGCGGGACGGAGGTGCGCCCTCGCTCGGTGGAGGTGGGTCTG
NM_183357.2         GCGGCGGCTGCCTCGGCGGGCGGGACGGAGGTGCGCCCTCGCTCGGTGGAGGTGGGTCTG
XM_005247077.1      GCGGCGGCTGCCTCGGCGGGCGGGACGGAGGTGCGCCCTCGCTCGGTGGAGGTGGGTCTG
                    ************************************************************

HsCD00082897        GAGGAGCGGCGGGGCAAGGGGCGCGCGGCCGACGAGCTGGAGGCCGGCGCCGTCGAGGGC
NM_183357.2         GAGGAGCGGCGGGGCAAGGGGCGCGCGGCCGACGAGCTGGAGGCCGGCGCCGTCGAGGGC
XM_005247077.1      GAGGAGCGGCGGGGCAAGGGGCGCGCGGCCGACGAGCTGGAGGCCGGCGCCGTCGAGGGC
                    ************************************************************

HsCD00082897        GGCGAGGGGTCCGGGGATGGCGGCAGCTCGGCGGACTCGGGCTCGGGCGCGGGGCCCGGC
NM_183357.2         GGCGAGGGGTCCGGGGATGGCGGCAGCTCGGCGGACTCGGGCTCGGGCGCGGGGCCCGGC
XM_005247077.1      GGCGAGGGGTCCGGGGATGGCGGCAGCTCGGCGGACTCGGGCTCGGGCGCGGGGCCCGGC
                    ************************************************************

HsCD00082897        GCGGTGCTGTCCCTGGGCGCCTGCTGCCTGGCGTTGCTGCAGATATTCCGCTCCAAGAAG
NM_183357.2         GCGGTGCTGTCCCTGGGCGCCTGCTGCCTGGCGTTGCTGCAGATATTCCGCTCCAAGAAG
XM_005247077.1      GCGGTGCTGTCCCTGGGCGCCTGCTGCCTGGCGTTGCTGCAGATATTCCGCTCCAAGAAG
                    ************************************************************

HsCD00082897        TTCCCGTCGGACAAACTGGAGCGGCTGTACCAGCGCTACTTCTTCCGCCTGAACCAGAGC
NM_183357.2         TTCCCGTCGGACAAACTGGAGCGGCTGTACCAGCGCTACTTCTTCCGCCTGAACCAGAGC
XM_005247077.1      TTCCCGTCGGACAAACTGGAGCGGCTGTACCAGCGCTACTTCTTCCGCCTGAACCAGAGC
                    ************************************************************

HsCD00082897        AGCCTCACCATGCTCATGGCCGTGCTGGTGCTCGTGTGCCTGGTCATGTTGGCCTTCCAC
NM_183357.2         AGCCTCACCATGCTCATGGCCGTGCTGGTGCTCGTGTGCCTGGTCATGTTGGCCTTCCAC
XM_005247077.1      AGCCTCACCATGCTCATGGCCGTGCTGGTGCTCGTGTGCCTGGTCATGTTGGCCTTCCAC
                    ************************************************************

HsCD00082897        GCGGCGCGGCCCCCGCTCCAGCTGCCCTACCTGGCCGTGCTGGCGGCCGCCGTCGGCGTG
NM_183357.2         GCGGCGCGGCCCCCGCTCCAGCTGCCCTACCTGGCCGTGCTGGCGGCCGCCGTCGGCGTG
XM_005247077.1      GCGGCGCGGCCCCCGCTCCAGCTGCCCTACCTGGCCGTGCTGGCGGCCGCCGTCGGCGTG
                    ************************************************************

HsCD00082897        ATCCTCATCATGGCTGTGCTTTGCAACCGCGCCGCCTTCCACCAGGACCACATGGGCCTG
NM_183357.2         ATCCTCATCATGGCTGTGCTTTGCAACCGCGCCGCCTTCCACCAGGACCACATGGGCCTG
XM_005247077.1      ATCCTCATCATGGCTGTGCTTTGCAACCGCGCCGCCTTCCACCAGGACCACATGGGCCTG
                    ************************************************************

HsCD00082897        GCCTGCTATGCGCTCATCGCCGTGGTGCTGGCCGTCCAGGTGGTGGGCCTGCTGCTGCCG
NM_183357.2         GCCTGCTATGCGCTCATCGCCGTGGTGCTGGCCGTCCAGGTGGTGGGCCTGCTGCTGCCG
XM_005247077.1      GCCTGCTATGCGCTCATCGCCGTGGTGCTGGCCGTCCAGGTGGTGGGCCTGCTGCTGCCG
                    ************************************************************

HsCD00082897        CAGCCACGCAGCGCCTCTGAGGGCATCTGGTGGACCGTGTTCTTCATCTACACCATCTAC
NM_183357.2         CAGCCACGCAGCGCCTCTGAGGGCATCTGGTGGACCGTGTTCTTCATCTACACCATCTAC
XM_005247077.1      CAGCCACGCAGCGCCTCTGAGGGCATCTGGTGGACCGTGTTCTTCATCTACACCATCTAC
                    ************************************************************

HsCD00082897        ACGCTGCTGCCCGTGCGCATGCGGGCCGCAGTGCTCAGCGGGGTGCTCCTGTCCGCCCTC
NM_183357.2         ACGCTGCTGCCCGTGCGCATGCGGGCCGCAGTGCTCAGCGGGGTGCTCCTGTCCGCCCTC
XM_005247077.1      ACGCTGCTGCCCGTGCGCATGCGGGCCGCAGTGCTCAGCGGGGTGCTCCTGTCCGCCCTC
                    ************************************************************

HsCD00082897        CACCTGGCCATCGCCCTGCGCACCAACGCCCAGGACCAGTTCCTGCTGAAGCAGCTTGTC
NM_183357.2         CACCTGGCCATCGCCCTGCGCACCAACGCCCAGGACCAGTTCCTGCTGAAGCAGCTTGTC
XM_005247077.1      CACCTGGCCATCGCCCTGCGCACCAACGCCCAGGACCAGTTCCTGCTGAAGCAGCTTGTC
                    ************************************************************

HsCD00082897        TCCAATGTTCTCATTTTCTCCTGCACCAACATCGTGGGTGTCTGCACCCACTATCCGGCT
NM_183357.2         TCCAATGTTCTCATTTTCTCCTGCACCAACATCGTGGGTGTCTGCACCCACTATCCGGCT
XM_005247077.1      TCCAATGTTCTCATTTTCTCCTGCACCAACATCGTGGGTGTCTGCACCCACTATCCGGCT
                    ************************************************************

HsCD00082897        GAGGTCTCCCAGAGACAGGCTTTCCAGGAGACCCGAGAGTGCATCCAGGCGCGGCTCCAC
NM_183357.2         GAGGTCTCCCAGAGACAGGCTTTCCAGGAGACCCGAGAGTGCATCCAGGCGCGGCTCCAC
XM_005247077.1      GAGGTCTCCCAGAGACAGGCTTTCCAGGAGACCCGAGAGTGCATCCAGGCGCGGCTCCAC
                    ************************************************************

HsCD00082897        TCGCAGCGGGAGAACCAGCAGCAGGAACGGCTCCTGCTGTCTGTCCTTCCCCGTCATGTT
NM_183357.2         TCGCAGCGGGAGAACCAGCAGCAGGAACGGCTCCTGCTGTCTGTCCTTCCCCGTCATGTT
XM_005247077.1      TCGCAGCGGGAGAACCAGCAGCAGGAACGGCTCCTGCTGTCTGTCCTTCCCCGTCATGTT
                    ************************************************************

HsCD00082897        GCCATGGAGATGAAAGCAGACATCAACGCCAAGCAGGAGGATATGATGTTCCATAAGATT
NM_183357.2         GCCATGGAGATGAAAGCAGACATCAACGCCAAGCAGGAGGATATGATGTTCCATAAGATT
XM_005247077.1      GCCATGGAGATGAAAGCAGACATCAACGCCAAGCAGGAGGATATGATGTTCCATAAGATT
                    ************************************************************

HsCD00082897        TACATCCAGAAACATGACAACGTGAGCATCCTGTTTGCTGACATCGAGGGCTTCACCAGC
NM_183357.2         TACATCCAGAAACATGACAACGTGAGCATCCTGTTTGCTGACATCGAGGGCTTCACCAGC
XM_005247077.1      TACATCCAGAAACATGACAACGTGAGCATCCTGTTTGCTGACATCGAGGGCTTCACCAGC
                    ************************************************************

HsCD00082897        CTGGCGTCCCAGTGCACTGCACAGGAACTGGTCATGACCCTCAACGAGCTCTTCGCCCGC
NM_183357.2         CTGGCGTCCCAGTGCACTGCACAGGAACTGGTCATGACCCTCAACGAGCTCTTCGCCCGC
XM_005247077.1      CTGGCGTCCCAGTGCACTGCACAGGAACTGGTCATGACCCTCAACGAGCTCTTCGCCCGC
                    ************************************************************

HsCD00082897        TTTGACAAGCTGGCCGCAGAGAATCACTGTTTACGTATTAAGATCCTTGGGGATTGTTAT
NM_183357.2         TTTGACAAGCTGGCCGCAGAGAATCACTGTTTACGTATTAAGATCCTTGGGGATTGTTAT
XM_005247077.1      TTTGACAAGCTGGCCGCAGAGAATCACTGTTTACGTATTAAGATCCTTGGGGATTGTTAT
                    ************************************************************

HsCD00082897        TACTGCGTCTCGGGGCTGCCTGAAGCAAGGGCTGACCACGCCCACTGCTGTGTGGAGATG
NM_183357.2         TACTGCGTCTCGGGGCTGCCTGAAGCAAGGGCTGACCACGCCCACTGCTGTGTGGAGATG
XM_005247077.1      TACTGCGTCTCGGGGCTGCCTGAAGCAAGGGCTGACCACGCCCACTGCTGTGTGGAGATG
                    ************************************************************

HsCD00082897        GGCATGGACATGATCGAGGCCATCTCGTTGGTCCGGGAGGTGACAGGGGTGAACGTGAAC
NM_183357.2         GGCATGGACATGATCGAGGCCATCTCGTTGGTCCGGGAGGTGACAGGGGTGAACGTGAAC
XM_005247077.1      GGCATGGACATGATCGAGGCCATCTCGTTGGTCCGGGAGGTGACAGGGGTGAACGTGAAC
                    ************************************************************

HsCD00082897        ATGCGTGTGGGAATTCACAGCGGGCGAGTACACTGCGGTGTCCTTGGTCTCAGGAAGTGG
NM_183357.2         ATGCGTGTGGGAATTCACAGCGGGCGAGTACACTGCGGTGTCCTTGGTCTCAGGAAGTGG
XM_005247077.1      ATGCGTGTGGGAATTCACAGCGGGCGAGTACACTGCGGTGTCCTTGGTCTCAGGAAGTGG
                    ************************************************************

HsCD00082897        CAGTTCGACGTCTGGTCTAACGATGTCACGCTAGCCAACCACATGGAGGCTGGCGGCAAG
NM_183357.2         CAGTTCGACGTCTGGTCTAACGATGTCACGCTAGCCAACCACATGGAGGCTGGCGGCAAG
XM_005247077.1      CAGTTCGACGTCTGGTCTAACGATGTCACGCTAGCCAACCACATGGAGGCTGGCGGCAAG
                    ************************************************************

HsCD00082897        GCAGGACGCATCCACATCACCAAGGCTACACTCAACTACCTGAATGGGGACTACGAGGTG
NM_183357.2         GCAGGACGCATCCACATCACCAAGGCTACACTCAACTACCTGAATGGGGACTACGAGGTG
XM_005247077.1      GCAGGACGCATCCACATCACCAAGGCTACACTCAACTACCTGAATGGGGACTACGAGGTG
                    ************************************************************

HsCD00082897        GAGCCAGGCTGTGGGGGCGAGCGCAACGCCTACCTCAAGGAGCACAGTATCGAGACCTTC
NM_183357.2         GAGCCAGGCTGTGGGGGCGAGCGCAACGCCTACCTCAAGGAGCACAGTATCGAGACCTTC
XM_005247077.1      GAGCCAGGCTGTGGGGGCGAGCGCAACGCCTACCTCAAGGAGCACAGTATCGAGACCTTC
                    ************************************************************

HsCD00082897        CTCATCCTGCGCTGCACCCAGAAGCGGAAAGAAGAGAAGGCCATGATCGCCAAGATGAAC
NM_183357.2         CTCATCCTGCGCTGCACCCAGAAGCGGAAAGAAGAGAAGGCCATGATCGCCAAGATGAAC
XM_005247077.1      CTCATCCTGCGCTGCACCCAGAAGCGGAAAGAAGAGAAGGCCATGATCGCCAAGATGAAC
                    ************************************************************

HsCD00082897        CGCCAGAGAACCAACTCCATCGGGCACAACCCACCACACTGGGGGGCTGAGCGCCCCTTC
NM_183357.2         CGCCAGAGAACCAACTCCATCGGGCACAACCCACCACACTGGGGGGCTGAGCGCCCCTTC
XM_005247077.1      CGCCAGAGAACCAACTCCATCGGGCACAACCCACCACACTGGGGGGCTGAGCGCCCCTTC
                    ************************************************************

HsCD00082897        TACAACCACCTGGGTGGCAACCAGGTGTCCAAGGAGATGAAGCGGATGGGCTTTGAAGAC
NM_183357.2         TACAACCACCTGGGTGGCAACCAGGTGTCCAAGGAGATGAAGCGGATGGGCTTTGAAGAC
XM_005247077.1      TACAACCACCTGGGTGGCAACCAGGTGTCCAAGGAGATGAAGCGGATGGGCTTTGAAGAC
                    ************************************************************

HsCD00082897        CCCAAGGACAAGAACGCCCAGGAGAGTGCGAACCCTGAGGATGAAGTGGATGAGTTTCTG
NM_183357.2         CCCAAGGACAAGAACGCCCAGGAGAGTGCGAACCCTGAGGATGAAGTGGATGAGTTTCTG
XM_005247077.1      CCCAAGGACAAGAACGCCCAGGAGAGTGCGAACCCTGAGGATGAAGTGGATGAGTTTCTG
                    ************************************************************

HsCD00082897        GGCCGTGCCATTGACGCCAGGAGCATTGATAGGCTTCGGTCTGAGCACGTCCGCAAGTTC
NM_183357.2         GGCCGTGCCATTGACGCCAGGAGCATTGATAGGCTTCGGTCTGAGCACGTCCGCAAGTTC
XM_005247077.1      GGCCGTGCCATTGACGCCAGGAGCATTGATAGGCTTCGGTCTGAGCACGTCCGCAAGTTC
                    ************************************************************

HsCD00082897        CTCCTGACCTTCAGGGAGCCTGACTTAGAGAAGAAGTACTCCAAGCAGGTAGACGACCGA
NM_183357.2         CTCCTGACCTTCAGGGAGCCTGACTTAGAGAAGAAGTACTCCAAGCAGGTAGACGACCGA
XM_005247077.1      CTCCTGACCTTCAGGGAGCCTGACTTAGAGAAGAAGTACTCCAAGCAGGTAGACGACCGA
                    ************************************************************

HsCD00082897        TTTGGTGCCTATGTGGCGTGTGCCTCGCTCGTCTTCCTCTTCATCTGCTTTGTCCAGATC
NM_183357.2         TTTGGTGCCTATGTGGCGTGTGCCTCGCTCGTCTTCCTCTTCATCTGCTTTGTCCAGATC
XM_005247077.1      TTTGGTGCCTATGTGGCGTGTGCCTCGCTCGTCTTCCTCTTCATCTGCTTTGTCCAGATC
                    ************************************************************

HsCD00082897        ACCATCGTGCCCCACTCCATATTCATGCTCAGCTTCTACCTGACCTGTTCCCTGCTGCTG
NM_183357.2         ACCATCGTGCCCCACTCCATATTCATGCTCAGCTTCTACCTGACCTGTTCCCTGCTGCTG
XM_005247077.1      ACCATCGTGCCCCACTCCATATTCATGCTCAGCTTCTACCTGACCTGTTCCCTGCTGCTG
                    ************************************************************

HsCD00082897        ACCTTGGTGGTGTTTGTGTCTGTGATCTACTCCTGCGTAAAGCTCTTCCCCTCCCCACTG
NM_183357.2         ACCTTGGTGGTGTTTGTGTCTGTGATCTACTCCTGCGTAAAGCTCTTCCCCTCCCCACTG
XM_005247077.1      ACCTTGGTGGTGTTTGTGTCTGTGATCTACTCCTGCGTAAAGCTCTTCCCCTCCCCACTG
                    ************************************************************

HsCD00082897        CAGACCCTCTCCAGGAAGATCGTGCGGTCCAAGATGAACAGCACCCTGGTTGGGGTGTTC
NM_183357.2         CAGACCCTCTCCAGGAAGATCGTGCGGTCCAAGATGAACAGCACCCTGGTTGGGGTGTTC
XM_005247077.1      CAGACCCTCTCCAGGAAGATCGTGCGGTCCAAGATGAACAGCACCCTGGTTGGGGTGTTC
                    ************************************************************

HsCD00082897        ACCATCACCCTGGTGTTCCTGGCGGCTTTTGTCAACATGTTCACGTGCAACTCCAGGGAC
NM_183357.2         ACCATCACCCTGGTGTTCCTGGCGGCTTTTGTCAACATGTTCACGTGCAACTCCAGGGAC
XM_005247077.1      ACCATCACCCTGGTGTTCCTGGCGGCTTTTGTCAACATGTTCACGTGCAACTCCAGGGAC
                    ************************************************************

HsCD00082897        CTGCTGGGCTGCTTGGCACAGGAGCACAACATCAGCGCGAGCCAGGTCAACGCGTGTCAC
NM_183357.2         CTGCTGGGCTGCTTGGCACAGGAGCACAACATCAGCGCGAGCCAGGTCAACGCGTGTCAC
XM_005247077.1      CTGCTGGGCTGCTTGGCACAGGAGCACAACATCAGCGCGAGCCAGGTCAACGCGTGTCAC
                    ************************************************************

HsCD00082897        GTGGCGGAGTCGGCCGTCAACTACAGCCTGGGCGATGAGCAGGGCTTCTGTGGCAGCCCC
NM_183357.2         GTGGCGGAGTCGGCCGTCAACTACAGCCTGGGCGATGAGCAGGGCTTCTGTGGCAGCCCC
XM_005247077.1      GTGGCGGAGTCGGCCGTCAACTACAGCCTGGGCGATGAGCAGGGCTTCTGTGGCAGCCCC
                    ************************************************************

HsCD00082897        TGGCCCAACTGCAACTTCCCCGAGTACTTCACCTACAGCGTGCTGCTCAGCCTGCTGGCC
NM_183357.2         TGGCCCAACTGCAACTTCCCCGAGTACTTCACCTACAGCGTGCTGCTCAGCCTGCTGGCC
XM_005247077.1      TGGCCCAACTGCAACTTCCCCGAGTACTTCACCTACAGCGTGCTGCTCAGCCTGCTGGCC
                    ************************************************************

HsCD00082897        TGCTCCGTGTTCCTGCAGATCAGCTGCATCGGGAAGCTGGTGCTCATGCTGGCCATCGAG
NM_183357.2         TGCTCCGTGTTCCTGCAGATCAGCTGCATCGGGAAGCTGGTGCTCATGCTGGCCATCGAG
XM_005247077.1      TGCTCCGTGTTCCTGCAGATCAGCTGCATCGGGAAGCTGGTGCTCATGCTGGCCATCGAG
                    ************************************************************

HsCD00082897        CTCATCTACGTGCTCATCGTGGAGGTGCCAGGTGTCACGCTCTTCGACAACGCCGACCTG
NM_183357.2         CTCATCTACGTGCTCATCGTGGAGGTGCCAGGTGTCACGCTCTTCGACAACGCCGACCTG
XM_005247077.1      CTCATCTACGTGCTCATCGTGGAGGTGCCAGGTGTCACGCTCTTCGACAACGCCGACCTG
                    ************************************************************

HsCD00082897        CTGGTCACCGCCAACGCCATAGACTTCTTCAACAACGGGACCTCCCAGTG----------
NM_183357.2         CTGGTCACCGCCAACGCCATAGACTTCTTCAACAACGGGACCTCCCAGTG----------
XM_005247077.1      CTGGTCACCGCCAACGCCATAGACTTCTTCAACAACGGGACCTCCCAGTGGAGCCTGTGT
                    **************************************************          

HsCD00082897        ------------------------------------------------------------
NM_183357.2         ------------------------------------------------------------
XM_005247077.1      GAGAACCTCAGACACAGGAGAATGGAAGCTGGTACCTACTTTCCCTCTGGAGTCAAGGAA
                                                                                

HsCD00082897        -----CCCTGAGCATGCAACCAAGGTGGCATTGAAGGTGGTGACGCCCATCATCATCTCA
NM_183357.2         -----CCCTGAGCATGCAACCAAGGTGGCATTGAAGGTGGTGACGCCCATCATCATCTCA
XM_005247077.1      CAAAGCCCTGAGCATGCAACCAAGGTGGCATTGAAGGTGGTGACGCCCATCATCATCTCA
                         *******************************************************

HsCD00082897        GTCTTTGTGCTGGCCCTGTACCTGCACGCCCAGCAGGTGGAGTCCACTGCCCGCCTCGAC
NM_183357.2         GTCTTTGTGCTGGCCCTGTACCTGCACGCCCAGCAGGTGGAGTCCACTGCCCGCCTCGAC
XM_005247077.1      GTCTTTGTGCTGGCCCTGTACCTGCACGCCCAGCAGGTGGAGTCCACTGCCCGCCTCGAC
                    ************************************************************

HsCD00082897        TTCCTCTGGAAACTGCAGGCCACAGAGGAGAAAGAGGAGATGGAGGAGCTGCAGGCCTAC
NM_183357.2         TTCCTCTGGAAACTGCAGGCCACAGAGGAGAAAGAGGAGATGGAGGAGCTGCAGGCCTAC
XM_005247077.1      TTCCTCTGGAAACTGCAGGCCACAGAGGAGAAAGAGGAGATGGAGGAGCTGCAGGCCTAC
                    ************************************************************

HsCD00082897        AACCGGCGGCTGCTGCACAACATCCTGCCCAAGGACGTGGCCGCTCACTTCCTGGCCCGC
NM_183357.2         AACCGGCGGCTGCTGCACAACATCCTGCCCAAGGACGTGGCCGCTCACTTCCTGGCCCGC
XM_005247077.1      AACCGGCGGCTGCTGCACAACATCCTGCCCAAGGACGTGGCCGCTCACTTCCTGGCCCGC
                    ************************************************************

HsCD00082897        GAGCGGCGCAATGATGAGCTCTACTATCAGTCCTGTGAGTGTGTGGCGGTCATGTTCGCC
NM_183357.2         GAGCGGCGCAATGATGAGCTCTACTATCAGTCCTGTGAGTGTGTGGCGGTCATGTTCGCC
XM_005247077.1      GAGCGGCGCAATGATGAGCTCTACTATCAGTCCTGTGAGTGTGTGGCGGTCATGTTCGCC
                    ************************************************************

HsCD00082897        TCCATCGCCAACTTCTCCGAGTTCTACGTTGAGCTGGAGGCCAACAACGAGGGTGTCGAG
NM_183357.2         TCCATCGCCAACTTCTCCGAGTTCTACGTTGAGCTGGAGGCCAACAACGAGGGTGTCGAG
XM_005247077.1      TCCATCGCCAACTTCTCCGAGTTCTACGTTGAGCTGGAGGCCAACAACGAGGGTGTCGAG
                    ************************************************************

HsCD00082897        TGCCTGCGGCTACTCAATGAGATCATCGCTGACTTTGATGAGATCATCAGCGAGGATCGG
NM_183357.2         TGCCTGCGGCTACTCAATGAGATCATCGCTGACTTTGATGAGATCATCAGCGAGGATCGG
XM_005247077.1      TGCCTGCGGCTACTCAATGAGATCATCGCTGACTTTGATGAGATCATCAGCGAGGATCGG
                    ************************************************************

HsCD00082897        TTCCGGCAGCTGGAGAAGATCAAGACCATCGGCAGCACCTACATGGCTGCCTCCGGCCTC
NM_183357.2         TTCCGGCAGCTGGAGAAGATCAAGACCATCGGCAGCACCTACATGGCTGCCTCCGGCCTC
XM_005247077.1      TTCCGGCAGCTGGAGAAGATCAAGACCATCGGCAGCACCTACATGGCTGCCTCCGGCCTC
                    ************************************************************

HsCD00082897        AACGACTCTACCTACGACAAGGTGGGCAAGACCCACATCAAGGCACTGGCCGACTTTGCC
NM_183357.2         AACGACTCTACCTACGACAAGGTGGGCAAGACCCACATCAAGGCACTGGCCGACTTTGCC
XM_005247077.1      AACGACTCTACCTACGACAAGGTGGGCAAGACCCACATCAAGGCACTGGCCGACTTTGCC
                    ************************************************************

HsCD00082897        ATGAAGCTGATGGACCAGATGAAGTACATCAATGAGCACTCCTTCAACAACTTCCAGATG
NM_183357.2         ATGAAGCTGATGGACCAGATGAAGTACATCAATGAGCACTCCTTCAACAACTTCCAGATG
XM_005247077.1      ATGAAGCTGATGGACCAGATGAAGTACATCAATGAGCACTCCTTCAACAACTTCCAGATG
                    ************************************************************

HsCD00082897        AAGATCGGGCTCAACATCGGCCCCGTGGTGGCCGGGGTGATAGGGGCACGAAAGCCTCAG
NM_183357.2         AAGATCGGGCTCAACATCGGCCCCGTGGTGGCCGGGGTGATAGGGGCACGAAAGCCTCAG
XM_005247077.1      AAGATCGGGCTCAACATCGGCCCCGTGGTGGCCGGGGTGATAGGGGCACGAAAGCCTCAG
                    ************************************************************

HsCD00082897        TACGACATCTGGGGCAATACCGTGAACGTGGCCAGCCGCATGGACAGCACCGGTGTACCC
NM_183357.2         TACGACATCTGGGGCAATACCGTGAACGTGGCCAGCCGCATGGACAGCACCGGTGTACCC
XM_005247077.1      TACGACATCTGGGGCAATACCGTGAACGTGGCCAGCCGCATGGACAGCACCGGTGTACCC
                    ************************************************************

HsCD00082897        GACCGCATCCAGGTCACCACAGACATGTACCAGGTGCTGGCTGCCAACACGTACCAGCTG
NM_183357.2         GACCGCATCCAGGTCACCACAGACATGTACCAGGTGCTGGCTGCCAACACGTACCAGCTG
XM_005247077.1      GACCGCATCCAGGTCACCACAGACATGTACCAGGTGCTGGCTGCCAACACGTACCAGCTG
                    ************************************************************

HsCD00082897        GAGTGCCGGGGCGTGGTCAAGGTCAAGGGCAAAGGCGAGATGATGACCTACTTCCTCAAT
NM_183357.2         GAGTGCCGGGGCGTGGTCAAGGTCAAGGGCAAAGGCGAGATGATGACCTACTTCCTCAAT
XM_005247077.1      GAGTGCCGGGGCGTGGTCAAGGTCAAGGGCAAAGGCGAGATGATGACCTACTTCCTCAAT
                    ************************************************************

HsCD00082897        GGAGGGCCCCCGCTCAGT---
NM_183357.2         GGAGGGCCCCCGCTCAGTTAG
XM_005247077.1      GGAGGGCCCCCGCTCAGTTAG
                    ******************   

Pathways

NCI : Endothelins
NCI : LPA receptor mediated events
NCI : LPA4-mediated signaling events
Panther : Endothelin signaling pathway
Panther : GABA-B receptor II signaling
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Reactome : Activation of GABAB receptors
Reactome : Adenylate cyclase activating pathway
Reactome : Adenylate cyclase inhibitory pathway
Reactome : Adrenaline,noradrenaline inhibits insulin secretion
Reactome : Aquaporin-mediated transport
Reactome : Ca-dependent events
Reactome : CaM pathway
Reactome : Calmodulin induced events
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : G alpha (i) signalling events
Reactome : G alpha (s) signalling events
Reactome : G alpha (z) signalling events
Reactome : G-protein mediated events
Reactome : GABA B receptor activation
Reactome : GABA receptor activation
Reactome : GPCR downstream signaling
Reactome : Glucagon signaling in metabolic regulation
Reactome : Glucagon-like Peptide-1 (GLP1) regulates insulin secretion
Reactome : Immune System
Reactome : Inhibition of adenylate cyclase pathway
Reactome : Innate Immune System
Reactome : Integration of energy metabolism
Reactome : Metabolism
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Opioid Signalling
Reactome : PKA activation
Reactome : PKA activation in glucagon signalling
Reactome : PKA-mediated phosphorylation of CREB
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Regulation of insulin secretion
Reactome : Regulation of water balance by renal Aquaporins
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
Reactome : Transmembrane transport of small molecules
Reactome : Transmission across Chemical Synapses
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : G Protein Signaling Pathways
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : CYCc : Adenylyl- / guanylyl cyclase, catalytic domain
UniProt : B7Z8A6
UniProt : B7Z2C7
UniProt : O95622
HPRD : 08973

Clone

Cloning Information : 269678
HIP Master Clone ID : 201180
IMAGE ID : 100061601
Original Clone ID : FLH269678.01L

Organism


TAX_ID : 9606
Species Specific ID: 111

Genome

Chromosome : 3
Map Location : 3q21.1
Ensembl : ENSG00000173175

Reagents

Labome : ADCY5-antibody