DNASU Plasmid Repository • 480.965.5697 | Email

KLF16 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  KLF16
Gene Name:  Kruppel-like factor 16
Sequence             
Original Clone ID: FLH269800.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00082923

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 759nts         Open reading frame : 1 to 759
Reference Sequence Alignment

ATGTCGGCGGCCGTGGCGTGCGTGGATTACTTCGCCGCCGACGTGCTCATGGCCATCTCT
TCGGGCGCCGTGGTGCACCGCGGGCGGCCCGGCCCCGAGGGCGCGGGCCCCGCCGCCGGC
CTGGATGTGCGCGCGGCGCGCCGCGAGGCCGCCTCACCCGGGACCCCGGGGCCACCCCCG
CCGCCCCCCGCCGCTTCTGGCCCGGGCCCCGGCGCCGCCGCGGCGCCCCACCTGCTGGCC
GCCAGCATCCTGGCCGACCTGCGCGGCGGACCCGGAGCCGCCCCGGGGGGCGCCTCGCCC
GCCTCCTCCTCCTCAGCCGCCTCGTCCCCGTCCTCGGGCCGCGCCCCCGGCGCCGCGCCC
TCCGCCGCCGCCAAGAGCCACCGCTGTCCCTTCCCGGACTGCGCCAAAGCCTACTACAAG
TCCTCGCACCTAAAGTCGCACCTGCGGACGCACACAGGGGAACGCCCTTTTGCTTGTGAC
TGGCAGGGCTGCGACAAGAAGTTCGCCCGCTCCGACGAGCTGGCCCGCCACCACCGGACG
CACACGGGCGAGAAGCGCTTCTCCTGCCCTCTGTGCTCCAAGCGCTTCACCCGCAGTGAC
CACCTGGCCAAGCACGCCCGCCGCCACCCCGGCTTCCACCCGGACCTGCTCCGGCGCCCT
GGTGCCCGCAGTACCTCCCCCAGCGACTCGCTGCCCTGCAGCCTGGCCGGGAGCCCTGCG
CCCAGCCCCGCGCCCAGCCCAGCCCCCGCAGGCCTGTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 827
Start on reference sequence 69
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : KLF16
Symbol Nomenclature : KLF16
SYNONYM : BTEB4; DRRF; NSLP2
Designation : BTE-binding protein 4|Krueppel-like factor 16|basic transcription element binding protein 4|basic transcription element-binding protein 4|dopamine receptor regulating factor|novel Sp1-like zinc finger transcription factor 2|transcription factor BTEB4|transcription factor NSLP2
Full Nomenclature : Kruppel-like factor 16
GENEID : 83855
GI : 151556591
GenBank Accession : BC148793
HGNC : 16857
MIM : 606139
Vega : OTTHUMG00000179994
Target GenBank: NM_031918

 

Reference Sequence Alignment

  

HsCD00082923      ATGTCGGCGGCCGTGGCGTGCGTGGATTACTTCGCCGCCGACGTGCTCATGGCCATCTCT
NM_031918.3       ATGTCGGCGGCCGTGGCGTGCGTGGATTACTTCGCCGCCGACGTGCTCATGGCCATCTCT
                  ************************************************************

HsCD00082923      TCGGGCGCCGTGGTGCACCGCGGGCGGCCCGGCCCCGAGGGCGCGGGCCCCGCCGCCGGC
NM_031918.3       TCGGGCGCCGTGGTGCACCGCGGGCGGCCCGGCCCCGAGGGCGCGGGCCCCGCCGCCGGC
                  ************************************************************

HsCD00082923      CTGGATGTGCGCGCGGCGCGCCGCGAGGCCGCCTCACCCGGGACCCCGGGGCCACCCCCG
NM_031918.3       CTGGATGTGCGCGCGGCGCGCCGCGAGGCCGCCTCACCCGGGACCCCGGGGCCACCCCCG
                  ************************************************************

HsCD00082923      CCGCCCCCCGCCGCTTCTGGCCCGGGCCCCGGCGCCGCCGCGGCGCCCCACCTGCTGGCC
NM_031918.3       CCGCCCCCCGCCGCTTCTGGCCCGGGCCCCGGCGCCGCCGCGGCGCCCCACCTGCTGGCC
                  ************************************************************

HsCD00082923      GCCAGCATCCTGGCCGACCTGCGCGGCGGACCCGGAGCCGCCCCGGGGGGCGCCTCGCCC
NM_031918.3       GCCAGCATCCTGGCCGACCTGCGCGGCGGACCCGGAGCCGCCCCGGGGGGCGCCTCGCCC
                  ************************************************************

HsCD00082923      GCCTCCTCCTCCTCAGCCGCCTCGTCCCCGTCCTCGGGCCGCGCCCCCGGCGCCGCGCCC
NM_031918.3       GCCTCCTCCTCCTCAGCCGCCTCGTCCCCGTCCTCGGGCCGCGCCCCCGGCGCCGCGCCC
                  ************************************************************

HsCD00082923      TCCGCCGCCGCCAAGAGCCACCGCTGTCCCTTCCCGGACTGCGCCAAAGCCTACTACAAG
NM_031918.3       TCCGCCGCCGCCAAGAGCCACCGCTGTCCCTTCCCGGACTGCGCCAAAGCCTACTACAAG
                  ************************************************************

HsCD00082923      TCCTCGCACCTAAAGTCGCACCTGCGGACGCACACAGGGGAACGCCCTTTTGCTTGTGAC
NM_031918.3       TCCTCGCACCTAAAGTCGCACCTGCGGACGCACACAGGGGAACGCCCTTTTGCTTGTGAC
                  ************************************************************

HsCD00082923      TGGCAGGGCTGCGACAAGAAGTTCGCCCGCTCCGACGAGCTGGCCCGCCACCACCGGACG
NM_031918.3       TGGCAGGGCTGCGACAAGAAGTTCGCCCGCTCCGACGAGCTGGCCCGCCACCACCGGACG
                  ************************************************************

HsCD00082923      CACACGGGCGAGAAGCGCTTCTCCTGCCCTCTGTGCTCCAAGCGCTTCACCCGCAGTGAC
NM_031918.3       CACACGGGCGAGAAGCGCTTCTCCTGCCCTCTGTGCTCCAAGCGCTTCACCCGCAGTGAC
                  ************************************************************

HsCD00082923      CACCTGGCCAAGCACGCCCGCCGCCACCCCGGCTTCCACCCGGACCTGCTCCGGCGCCCT
NM_031918.3       CACCTGGCCAAGCACGCCCGCCGCCACCCCGGCTTCCACCCGGACCTGCTCCGGCGCCCT
                  ************************************************************

HsCD00082923      GGTGCCCGCAGTACCTCCCCCAGCGACTCGCTGCCCTGCAGCCTGGCCGGGAGCCCTGCG
NM_031918.3       GGTGCCCGCAGTACCTCCCCCAGCGACTCGCTGCCCTGCAGCCTGGCCGGGAGCCCTGCG
                  ************************************************************

HsCD00082923      CCCAGCCCCGCGCCCAGCCCAGCCCCCGCAGGCCTGTAA
NM_031918.3       CCCAGCCCCGCGCCCAGCCCAGCCCCCGCAGGCCTGTAG
                  **************************************.

Protein

SMART domain : ZnF_C2H2 : zinc finger
UniProt : Q9BXK1
HPRD : 12090

Clone

Cloning Information : 269800
HIP Master Clone ID : 201302
IMAGE ID : 100015888
Original Clone ID : FLH269800.01X

Organism


TAX_ID : 9606
Species Specific ID: 83855

Genome

Chromosome : 19
Map Location : 19p13.3
Ensembl : ENSG00000129911

Reagents

Labome : KLF16-antibody