DNASU Plasmid Repository • 480.965.5697 | Email

NALP13 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NLRP13
Gene Name:  NLR family, pyrin domain containing 13
Sequence             
Original Clone ID: FLH269814.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00082937

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3132nts         Open reading frame : 1 to 3132
Reference Sequence Alignment

ATGAACTTTTCTGTAATCACCTGCCCCAACGGTGGTACCAACCAAGGGCTTCTGCCTTAC
CTGATGGCCCTGGATCAGTATCAGCTGGAGGAATTCAAGCTTTGCTTGGAACCCCAGCAG
CTGATGGACTTCTGGTCGGCCCCCCAGGGGCACTTCCCGCGTATCCCCTGGGCAAACTTG
AGAGCTGCCGACCCTTTGAATCTGTCCTTTCTTTTGGATGAACACTTCCCAAAAGGTCAG
GCATGGAAAGTGGTCCTCGGCATCTTCCAGACAATGAATCTGACCTCACTGTGTGAGAAA
GTTAGAGCCGAGATGAAAGAGAATGTGCAGACCCAAGAGCTGCAAGATCCAACCCAGGAA
GATCTAGAGATGCTAGAAGCAGCAGCAGGGAATATGCAGACCCAGGGATGCCAAGATCCA
AACCAAGAAGAACTAGACGAGCTAGAAGAAGAAACAGGGAATGTACAGGCCCAGGGATGC
CAAGATCCAAACCAAGAAGAACCAGAGATGCTAGAGGAAGCAGACCACAGAAGAAAATAC
AGAGAGAACATGAAGGCTGAACTACTGGAGACATGGGACAACATCAGTTGGCCTAAAGAC
CACGTATATATCCGTAATACATCAAAGGACGAACATGAGGAACTGCAGCGCCTACTGGAT
CCTAATAGGACTAGAGCCCAGGCCCAGACGATAGTCTTGGTGGGGAGGGCAGGGGTTGGG
AAGACCACCTTGGCAATGCAGGCTATGCTGCACTGGGCAAATGGAGTTCTCTTTCAGCAA
AGGTTCTCCTATGTTTTCTATCTCAGCTGCCATAAAATAAGGTACATGAAGGAAACTACC
TTTGCTGAATTGATTTCTTTGGATTGGCCCGATTTTGATGCCCCCATTGAAGAGTTCATG
TCTCAACCAGAGAAGCTCCTGTTTATTATTGATGGCTTTGAGGAAATAATCATATCTGAG
TCACGCTCTGAGAGCTTGGATGATGGCTCGCCATGTACAGACTGGTACCAGGAGCTCCCA
GTGACCAAAATCCTACACAGCTTGTTGAAGAAAGAATTGGTTCCCCTGGCTACCTTACTG
ATCACGATCAAGACCTGGTTTGTGAGAGATCTTAAGGCCTCATTAGTGAATCCATGCTTT
GTACAAATTACAGGGTTCACAGGGGACGACCTACGGGTATATTTCATGAGACACTTTGAT
GACTCAAGTGAAGTTGAGAAAATCCTGCAGCAGCTAAGAAAAAACGAAACTCTCTTTCAT
TCCTGCAGTGCCCCCATGGTGTGTTGGACCGTATGTTCCTGTCTGAAGCAGCCGAAGGTG
AGGTATTACGATCTCCAGTCAATCACTCAGACTACCACCAGTCTGTATGCCTATTTTTTC
TCCAACTTGTTCTCCACAGCAGAGGTAGATTTGGCAGATGACAGCTGGCCAGGACAATGG
AGGGCCCTCTGCAGTCTGGCCATAGAAGGGCTGTGGTCTATGAACTTCACGTTTAACAAA
GAAGACACTGAGATCGAGGGCCTGGAAGTGCCTTTCATTGATTCTCTCTACGAGTTCAAT
ATTCTTCAAAAGATCAATGACTGTGGGGGTTGCACTACTTTCACCCACCTAAGTTTCCAG
GAGTTTTTTGCAGCCATGTCCTTTGTGCTAGAGGAACCTAGAGAATTCCCTCCCCATTCC
ACAAAGCCACAAGAGATGAAGATGTTACTGCAACACGTCTTGCTTGACAAAGAAGCCTAC
TGGACTCCAGTGGTTCTGTTCTTCTTTGGTCTTTTAAATAAAAACATAGCAAGAGAACTG
GAAGATACTTTGCATTGTAAAATATCTCCCAGGGTAATGGAGGAATTATTAAAGTGGGGA
GAAGAGTTAGGTAAGGCTGAAAGTGCCTCTCTCCAATTTCACATTCTACGACTTTTTCAC
TGCCTACACGAGTCCCAGGAGGAAGACTTCACAAAGAAGATGTTGGGTCGTATCTTTGAA
GTTGACCTTAATATTTTGGAGGACGAAGAACTCCAAGCTTCTTCATTTTGCCTAAAGCAC
TGTAAAAGGTTAAATAAGCTAAGGCTTTCTGTTAGCAGTCACATCCTTGAAAGGGACTTG
GAAATTCTGGAGACAAGCAAGTTTGATTCCAGGATGCACGCATGGAACAGCATTTGCTCT
ACGTTGGTCACAAATGAGAATCTGCATGAGCTAGACCTGAGTAACAGCAAACTTCATGCT
TCCTCTGTGAAGGGTCTCTGTCTTGCACTGAAAAATCCAAGATGCAAAGTCCAGAAACTG
ACGTGCAAATCGGTAACTCCTGAGTGGGTTCTGCAGGACCTCATTATTGCCCTTCAGGGT
AACAGCAAGCTGACCCATCTGAACTTCAGCTCTAACAAGCTGGGAATGACTGTCCCCCTG
ATTCTTAAAGCTTTGAGACACTCAGCTTGCAACCTCAAGTATCTGTGCCTGGAGAAATGC
AACTTGTCGGCAGCCAGCTGTCAGGACCTAGCCTTGTTTCTCACCAGCATCCAACACGTA
ACTCGATTGTGCCTGGGATTTAATCGGCTCCAAGATGATGGCATAAAGCTATTGTGTGCG
GCCCTGACTCACCCCAAGTGTGCCTTAGAGAGACTGGAGCTCTGGTTTTGCCAGCTGGCA
GCACCCGCTTGCAAGCACTTGTCAGATGCTCTCCTGCAGAACAGGAGCCTGACACACCTG
AATCTGAGCAAGAACAGCCTGAGAGACGAGGGAGTCAAGTTCCTGTGTGAGGCCTTGGGT
CGCCCAGATGGTAACCTGCAGAGCCTGAATTTGTCAGGTTGTTCTTTCACAAGAGAGGGC
TGTGGAGAGCTGGCTAATGCCCTCAGCCATAATCATAATGTGAAAATCTTGGATTTGGGA
GAAAATGATCTTCAGGATGATGGAGTGAAGCTACTGTGTGAGGCTCTGAAACCACATCGT
GCATTGCACACACTTGGGTTGGCGAAATGCAATCTGACAACTGCTTGCTGCCAGCATCTC
TTCTCTGTTCTCAGCAGCAGTAAGAGCCTGGTCAATCTGAACCTTCTAGGCAATGAATTG
GATACTGATGGTGTCAAGATGCTATGTAAGGCTTTGAAAAAGTCGACATGCAGGCTGCAG
AAACTCGGGTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3157
Start on reference sequence 26
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NLRP13
Symbol Nomenclature : NLRP13
SYNONYM : CLR19.7; NALP13; NOD14; PAN13
Designation : NACHT, LRR and PYD containing protein 13|NACHT, LRR and PYD domains-containing protein 13|NACHT, leucine rich repeat and PYD containing 13|nucleotide-binding oligomerization domain protein 14|nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13
Full Nomenclature : NLR family, pyrin domain containing 13
GENEID : 126204
GI : 151555136
GenBank Accession : BC148742
HGNC : 22937
MIM : 609660
Vega : OTTHUMG00000167839
Target GenBank: NM_176810

 

Reference Sequence Alignment

  

HsCD00082937        ATGAACTTTTCTGTAATCACCTGCCCCAACGGTGGTACCAACCAAGGGCTTCTGCCTTAC
NM_176810.2         ATGAACTTTTCTGTAATCACCTGCCCCAACGGTGGTACCAACCAAGGGCTTCTGCCTTAC
XM_005258510.1      ATGAACTTTTCTGTAATCACCTGCCCCAACGGTGGTACCAACCAAGGGCTTCTGCCTTAC
                    ************************************************************

HsCD00082937        CTGATGGCCCTGGATCAGTATCAGCTGGAGGAATTCAAGCTTTGCTTGGAACCCCAGCAG
NM_176810.2         CTGATGGCCCTGGATCAGTATCAGCTGGAGGAATTCAAGCTTTGCTTGGAACCCCAGCAG
XM_005258510.1      CTGATGGCCCTGGATCAGTATCAGCTGGAGGAATTCAAGCTTTGCTTGGAACCCCAGCAG
                    ************************************************************

HsCD00082937        CTGATGGACTTCTGGTCGGCCCCCCAGGGGCACTTCCCGCGTATCCCCTGGGCAAACTTG
NM_176810.2         CTGATGGACTTCTGGTCGGCCCCCCAGGGGCACTTCCCGCGTATCCCCTGGGCAAACTTG
XM_005258510.1      CTGATGGACTTCTGGTCGGCCCCCCAGGGGCACTTCCCGCGTATCCCCTGGGCAAACTTG
                    ************************************************************

HsCD00082937        AGAGCTGCCGACCCTTTGAATCTGTCCTTTCTTTTGGATGAACACTTCCCAAAAGGTCAG
NM_176810.2         AGAGCTGCCGACCCTTTGAATCTGTCCTTTCTTTTGGATGAACACTTCCCAAAAGGTCAG
XM_005258510.1      AGAGCTGCCGACCCTTTGAATCTGTCCTTTCTTTTGGATGAACACTTCCCAAAAGGTCAG
                    ************************************************************

HsCD00082937        GCATGGAAAGTGGTCCTCGGCATCTTCCAGACAATGAATCTGACCTCACTGTGTGAGAAA
NM_176810.2         GCATGGAAAGTGGTCCTCGGCATCTTCCAGACAATGAATCTGACCTCACTGTGTGAGAAA
XM_005258510.1      GCATGGAAAGTGGTCCTCGGCATCTTCCAGACAATGAATCTGACCTCACTGTGTGAGAAA
                    ************************************************************

HsCD00082937        GTTAGAGCCGAGATGAAAGAGAATGTGCAGACCCAAGAGCTGCAAGATCCAACCCAGGAA
NM_176810.2         GTTAGAGCCGAGATGAAAGAGAATGTGCAGACCCAAGAGCTGCAAGATCCAACCCAGGAA
XM_005258510.1      GTTAGAGCCGAGATGAAAGAGAATGTGCAGACCCAAGAGCTGCAAGATCCAACCCAGGAA
                    ************************************************************

HsCD00082937        GATCTAGAGATGCTAGAAGCAGCAGCAGGGAATATGCAGACCCAGGGATGCCAAGATCCA
NM_176810.2         GATCTAGAGATGCTAGAAGCAGCAGCAGGGAATATGCAGACCCAGGGATGCCAAGATCCA
XM_005258510.1      GATCTAGAGATGCTAGAAGCAGCAGCAGGGAATATGCAGACCCAGGGATGCCAAGATCCA
                    ************************************************************

HsCD00082937        AACCAAGAAGAACTAGACGAGCTAGAAGAAGAAACAGGGAATGTACAGGCCCAGGGATGC
NM_176810.2         AACCAAGAAGAACTAGACGAGCTAGAAGAAGAAACAGGGAATGTACAGGCCCAGGGATGC
XM_005258510.1      AACCAAGAAGAACTAGACGAGCTAGAAGAAGAAACAGGGAATGTACAGGCCCAGGGATGC
                    ************************************************************

HsCD00082937        CAAGATCCAAACCAAGAAGAACCAGAGATGCTAGAGGAAGCAGACCACAGAAGAAAATAC
NM_176810.2         CAAGATCCAAACCAAGAAGAACCAGAGATGCTAGAGGAAGCAGACCACAGAAGAAAATAC
XM_005258510.1      CAAGATCCAAACCAAGAAGAACCAGAGATGCTAGAGGAAGCAGACCACAGAAGAAAATAC
                    ************************************************************

HsCD00082937        AGAGAGAACATGAAGGCTGAACTACTGGAGACATGGGACAACATCAGTTGGCCTAAAGAC
NM_176810.2         AGAGAGAACATGAAGGCTGAACTACTGGAGACATGGGACAACATCAGTTGGCCTAAAGAC
XM_005258510.1      AGAGAGAACATGAAGGCTGAACTACTGGAGACATGGGACAACATCAGTTGGCCTAAAGAC
                    ************************************************************

HsCD00082937        CACGTATATATCCGTAATACATCAAAGGACGAACATGAGGAACTGCAGCGCCTACTGGAT
NM_176810.2         CACGTATATATCCGTAATACATCAAAGGACGAACATGAGGAACTGCAGCGCCTACTGGAT
XM_005258510.1      CACGTATATATCCGTAATACATCAAAGGACGAACATGAGGAACTGCAGCGCCTACTGGAT
                    ************************************************************

HsCD00082937        CCTAATAGGACTAGAGCCCAGGCCCAGACGATAGTCTTGGTGGGGAGGGCAGGGGTTGGG
NM_176810.2         CCTAATAGGACTAGAGCCCAGGCCCAGACGATAGTCTTGGTGGGGAGGGCAGGGGTTGGG
XM_005258510.1      CCTAATAGGACTAGAGCCCAGGCCCAGACGATAGTCTTGGTGGGGAGGGCAGGGGTTGGG
                    ************************************************************

HsCD00082937        AAGACCACCTTGGCAATGCAGGCTATGCTGCACTGGGCAAATGGAGTTCTCTTTCAGCAA
NM_176810.2         AAGACCACCTTGGCAATGCAGGCTATGCTGCACTGGGCAAATGGAGTTCTCTTTCAGCAA
XM_005258510.1      AAGACCACCTTGGCAATGCAGGCTATGCTGCACTGGGCAAATGGAGTTCTCTTTCAGCAA
                    ************************************************************

HsCD00082937        AGGTTCTCCTATGTTTTCTATCTCAGCTGCCATAAAATAAGGTACATGAAGGAAACTACC
NM_176810.2         AGGTTCTCCTATGTTTTCTATCTCAGCTGCCATAAAATAAGGTACATGAAGGAAACTACC
XM_005258510.1      AGGTTCTCCTATGTTTTCTATCTCAGCTGCCATAAAATAAGGTACATGAAGGAAACTACC
                    ************************************************************

HsCD00082937        TTTGCTGAATTGATTTCTTTGGATTGGCCCGATTTTGATGCCCCCATTGAAGAGTTCATG
NM_176810.2         TTTGCTGAATTGATTTCTTTGGATTGGCCCGATTTTGATGCCCCCATTGAAGAGTTCATG
XM_005258510.1      TTTGCTGAATTGATTTCTTTGGATTGGCCCGATTTTGATGCCCCCATTGAAGAGTTCATG
                    ************************************************************

HsCD00082937        TCTCAACCAGAGAAGCTCCTGTTTATTATTGATGGCTTTGAGGAAATAATCATATCTGAG
NM_176810.2         TCTCAACCAGAGAAGCTCCTGTTTATTATTGATGGCTTTGAGGAAATAATCATATCTGAG
XM_005258510.1      TCTCAACCAGAGAAGCTCCTGTTTATTATTGATGGCTTTGAGGAAATAATCATATCTGAG
                    ************************************************************

HsCD00082937        TCACGCTCTGAGAGCTTGGATGATGGCTCGCCATGTACAGACTGGTACCAGGAGCTCCCA
NM_176810.2         TCACGCTCTGAGAGCTTGGATGATGGCTCGCCATGTACAGACTGGTACCAGGAGCTCCCA
XM_005258510.1      TCACGCTCTGAGAGCTTGGATGATGGCTCGCCATGTACAGACTGGTACCAGGAGCTCCCA
                    ************************************************************

HsCD00082937        GTGACCAAAATCCTACACAGCTTGTTGAAGAAAGAATTGGTTCCCCTGGCTACCTTACTG
NM_176810.2         GTGACCAAAATCCTACACAGCTTGTTGAAGAAAGAATTGGTTCCCCTGGCTACCTTACTG
XM_005258510.1      GTGACCAAAATCCTACACAGCTTGTTGAAGAAAGAATTGGTTCCCCTGGCTACCTTACTG
                    ************************************************************

HsCD00082937        ATCACGATCAAGACCTGGTTTGTGAGAGATCTTAAGGCCTCATTAGTGAATCCATGCTTT
NM_176810.2         ATCACGATCAAGACCTGGTTTGTGAGAGATCTTAAGGCCTCATTAGTGAATCCATGCTTT
XM_005258510.1      ATCACGATCAAGACCTGGTTTGTGAGAGATCTTAAGGCCTCATTAGTGAATCCATGCTTT
                    ************************************************************

HsCD00082937        GTACAAATTACAGGGTTCACAGGGGACGACCTACGGGTATATTTCATGAGACACTTTGAT
NM_176810.2         GTACAAATTACAGGGTTCACAGGGGACGACCTACGGGTATATTTCATGAGACACTTTGAT
XM_005258510.1      GTACAAATTACAGGGTTCACAGGGGACGACCTACGGGTATATTTCATGAGACACTTTGAT
                    ************************************************************

HsCD00082937        GACTCAAGTGAAGTTGAGAAAATCCTGCAGCAGCTAAGAAAAAACGAAACTCTCTTTCAT
NM_176810.2         GACTCAAGTGAAGTTGAGAAAATCCTGCAGCAGCTAAGAAAAAACGAAACTCTCTTTCAT
XM_005258510.1      GACTCAAGTGAAGTTGAGAAAATCCTGCAGCAGCTAAGAAAAAACGAAACTCTCTTTCAT
                    ************************************************************

HsCD00082937        TCCTGCAGTGCCCCCATGGTGTGTTGGACCGTATGTTCCTGTCTGAAGCAGCCGAAGGTG
NM_176810.2         TCCTGCAGTGCCCCCATGGTGTGTTGGACCGTATGTTCCTGTCTGAAGCAGCCGAAGGTG
XM_005258510.1      TCCTGCAGTGCCCCCATGGTGTGTTGGACCGTATGTTCCTGTCTGAAGCAGCCGAAGGTG
                    ************************************************************

HsCD00082937        AGGTATTACGATCTCCAGTCAATCACTCAGACTACCACCAGTCTGTATGCCTATTTTTTC
NM_176810.2         AGGTATTACGATCTCCAGTCAATCACTCAGACTACCACCAGTCTGTATGCCTATTTTTTC
XM_005258510.1      AGGTATTACGATCTCCAGTCAATCACTCAGACTACCACCAGTCTGTATGCCTATTTTTTC
                    ************************************************************

HsCD00082937        TCCAACTTGTTCTCCACAGCAGAGGTAGATTTGGCAGATGACAGCTGGCCAGGACAATGG
NM_176810.2         TCCAACTTGTTCTCCACAGCAGAGGTAGATTTGGCAGATGACAGCTGGCCAGGACAATGG
XM_005258510.1      TCCAACTTGTTCTCCACAGCAGAGGTAGATTTGGCAGATGACAGCTGGCCAGGACAATGG
                    ************************************************************

HsCD00082937        AGGGCCCTCTGCAGTCTGGCCATAGAAGGGCTGTGGTCTATGAACTTCACGTTTAACAAA
NM_176810.2         AGGGCCCTCTGCAGTCTGGCCATAGAAGGGCTGTGGTCTATGAACTTCACGTTTAACAAA
XM_005258510.1      AGGGCCCTCTGCAGTCTGGCCATAGAAGGGCTGTGGTCTATGAACTTCACGTTTAACAAA
                    ************************************************************

HsCD00082937        GAAGACACTGAGATCGAGGGCCTGGAAGTGCCTTTCATTGATTCTCTCTACGAGTTCAAT
NM_176810.2         GAAGACACTGAGATCGAGGGCCTGGAAGTGCCTTTCATTGATTCTCTCTACGAGTTCAAT
XM_005258510.1      GAAGACACTGAGATCGAGGGCCTGGAAGTGCCTTTCATTGATTCTCTCTACGAGTTCAAT
                    ************************************************************

HsCD00082937        ATTCTTCAAAAGATCAATGACTGTGGGGGTTGCACTACTTTCACCCACCTAAGTTTCCAG
NM_176810.2         ATTCTTCAAAAGATCAATGACTGTGGGGGTTGCACTACTTTCACCCACCTAAGTTTCCAG
XM_005258510.1      ATTCTTCAAAAGATCAATGACTGTGGGGGTTGCACTACTTTCACCCACCTAAGTTTCCAG
                    ************************************************************

HsCD00082937        GAGTTTTTTGCAGCCATGTCCTTTGTGCTAGAGGAACCTAGAGAATTCCCTCCCCATTCC
NM_176810.2         GAGTTTTTTGCAGCCATGTCCTTTGTGCTAGAGGAACCTAGAGAATTCCCTCCCCATTCC
XM_005258510.1      GAGTTTTTTGCAGCCATGTCCTTTGTGCTAGAGGAACCTAGAGAATTCCCTCCCCATTCC
                    ************************************************************

HsCD00082937        ACAAAGCCACAAGAGATGAAGATGTTACTGCAACACGTCTTGCTTGACAAAGAAGCCTAC
NM_176810.2         ACAAAGCCACAAGAGATGAAGATGTTACTGCAACACGTCTTGCTTGACAAAGAAGCCTAC
XM_005258510.1      ACAAAGCCACAAGAGATGAAGATGTTACTGCAACACGTCTTGCTTGACAAAGAAGCCTAC
                    ************************************************************

HsCD00082937        TGGACTCCAGTGGTTCTGTTCTTCTTTGGTCTTTTAAATAAAAACATAGCAAGAGAACTG
NM_176810.2         TGGACTCCAGTGGTTCTGTTCTTCTTTGGTCTTTTAAATAAAAACATAGCAAGAGAACTG
XM_005258510.1      TGGACTCCAGTGGTTCTGTTCTTCTTTGGTCTTTTAAATAAAAACATAGCAAGAGAACTG
                    ************************************************************

HsCD00082937        GAAGATACTTTGCATTGTAAAATATCTCCCAGGGTAATGGAGGAATTATTAAAGTGGGGA
NM_176810.2         GAAGATACTTTGCATTGTAAAATATCTCCCAGGGTAATGGAGGAATTATTAAAGTGGGGA
XM_005258510.1      GAAGATACTTTGCATTGTAAAATATCTCCCAGGGTAATGGAGGAATTATTAAAGTGGGGA
                    ************************************************************

HsCD00082937        GAAGAGTTAGGTAAGGCTGAAAGTGCCTCTCTCCAATTTCACATTCTACGACTTTTTCAC
NM_176810.2         GAAGAGTTAGGTAAGGCTGAAAGTGCCTCTCTCCAATTTCACATTCTACGACTTTTTCAC
XM_005258510.1      GAAGAGTTAGGTAAGGCTGAAAGTGCCTCTCTCCAATTTCACATTCTACGACTTTTTCAC
                    ************************************************************

HsCD00082937        TGCCTACACGAGTCCCAGGAGGAAGACTTCACAAAGAAGATGTTGGGTCGTATCTTTGAA
NM_176810.2         TGCCTACACGAGTCCCAGGAGGAAGACTTCACAAAGAAGATGTTGGGTCGTATCTTTGAA
XM_005258510.1      TGCCTACACGAGTCCCAGGAGGAAGACTTCACAAAGAAGATGTTGGGTCGTATCTTTGAA
                    ************************************************************

HsCD00082937        GTTGACCTTAATATTTTGGAGGACGAAGAACTCCAAGCTTCTTCATTTTGCCTAAAGCAC
NM_176810.2         GTTGACCTTAATATTTTGGAGGACGAAGAACTCCAAGCTTCTTCATTTTGCCTAAAGCAC
XM_005258510.1      GTTGACCTTAATATTTTGGAGGACGAAGAACTCCAAGCTTCTTCATTTTGCCTAAAGCAC
                    ************************************************************

HsCD00082937        TGTAAAAGGTTAAATAAGCTAAGGCTTTCTGTTAGCAGTCACATCCTTGAAAGGGACTTG
NM_176810.2         TGTAAAAGGTTAAATAAGCTAAGGCTTTCTGTTAGCAGTCACATCCTTGAAAGGGACTTG
XM_005258510.1      TGTAAAAGGTTAAATAAGCTAAGGCTTTCTGTTAGCAGTCACATCCTTGAAAGGGACTTG
                    ************************************************************

HsCD00082937        GAAATTCTGGAGACAAGCAAGTTTGATTCCAGGATGCACGCATGGAACAGCATTTGCTCT
NM_176810.2         GAAATTCTGGAGACAAGCAAGTTTGATTCCAGGATGCACGCATGGAACAGCATTTGCTCT
XM_005258510.1      GAAATTCTGGAGACAAGCAAGTTTGATTCCAGGATGCACGCATGGAACAGCATTTGCTCT
                    ************************************************************

HsCD00082937        ACGTTGGTCACAAATGAGAATCTGCATGAGCTAGACCTGAGTAACAGCAAACTTCATGCT
NM_176810.2         ACGTTGGTCACAAATGAGAATCTGCATGAGCTAGACCTGAGTAACAGCAAACTTCATGCT
XM_005258510.1      ACGTTGGTCACAAATGAGAATCTGCATGAGCTAGACCTGAGTAACAGCAAACTTCATGCT
                    ************************************************************

HsCD00082937        TCCTCTGTGAAGGGTCTCTGTCTTGCACTGAAAAATCCAAGATGCAAAGTCCAGAAACTG
NM_176810.2         TCCTCTGTGAAGGGTCTCTGTCTTGCACTGAAAAATCCAAGATGCAAAGTCCAGAAACTG
XM_005258510.1      TCCTCTGTGAAGGGTCTCTGTCTTGCACTGAAAAATCCAAGATGCAAAGTCCAGAAACTG
                    ************************************************************

HsCD00082937        ACGTGCAAATCGGTAACTCCTGAGTGGGTTCTGCAGGACCTCATTATTGCCCTTCAGGGT
NM_176810.2         ACGTGCAAATCGGTAACTCCTGAGTGGGTTCTGCAGGACCTCATTATTGCCCTTCAGGGT
XM_005258510.1      ACGTGCAAATCGGTAACTCCTGAGTGGGTTCTGCAGGACCTCATTATTGCCCTTCAGGGT
                    ************************************************************

HsCD00082937        AACAGCAAGCTGACCCATCTGAACTTCAGCTCTAACAAGCTGGGAATGACTGTCCCCCTG
NM_176810.2         AACAGCAAGCTGACCCATCTGAACTTCAGCTCTAACAAGCTGGGAATGACTGTCCCCCTG
XM_005258510.1      AACAGCAAGCTGACCCATCTGAACTTCAGCTCTAACAAGCTGGGAATGACTGTCCCCCTG
                    ************************************************************

HsCD00082937        ATTCTTAAAGCTTTGAGACACTCAGCTTGCAACCTCAAGTATCTGTGCCTGGAGAAATGC
NM_176810.2         ATTCTTAAAGCTTTGAGACACTCAGCTTGCAACCTCAAGTATCTGTGCCTGGAGAAATGC
XM_005258510.1      ATTCTTAAAGCTTTGAGACACTCAGCTTGCAACCTCAAGTATCTGTGCCTGGAGAAATGC
                    ************************************************************

HsCD00082937        AACTTGTCGGCAGCCAGCTGTCAGGACCTAGCCTTGTTTCTCACCAGCATCCAACACGTA
NM_176810.2         AACTTGTCGGCAGCCAGCTGTCAGGACCTAGCCTTGTTTCTCACCAGCATCCAACACGTA
XM_005258510.1      AACTTGTCGGCAGCCAGCTGTCAGGACCTAGCCTTGTTTCTCACCAGCATCCAACACGTA
                    ************************************************************

HsCD00082937        ACTCGATTGTGCCTGGGATTTAATCGGCTCCAAGATGATGGCATAAAGCTATTGTGTGCG
NM_176810.2         ACTCGATTGTGCCTGGGATTTAATCGGCTCCAAGATGATGGCATAAAGCTATTGTGTGCG
XM_005258510.1      ACTCGATTGTGCCTGGGATTTAATCGGCTCCAAGATGATGGCATAAAGCTATTGTGTGCG
                    ************************************************************

HsCD00082937        GCCCTGACTCACCCCAAGTGTGCCTTAGAGAGACTGGAGCTCTGGTTTTGCCAGCTGGCA
NM_176810.2         GCCCTGACTCACCCCAAGTGTGCCTTAGAGAGACTGGAGCTCTGGTTTTGCCAGCTGGCA
XM_005258510.1      GCCCTGACTCACCCCAAGTGTGCCTTAGAGAGACTGGAGCTCTGGTTTTGCCAGCTGGCA
                    ************************************************************

HsCD00082937        GCACCCGCTTGCAAGCACTTGTCAGATGCTCTCCTGCAGAACAGGAGCCTGACACACCTG
NM_176810.2         GCACCCGCTTGCAAGCACTTGTCAGATGCTCTCCTGCAGAACAGGAGCCTGACACACCTG
XM_005258510.1      GCACCCGCTTGCAAGCACTTGTCAGATGCTCTCCTGCAGAACAGGAGCCTGACACACCTG
                    ************************************************************

HsCD00082937        AATCTGAGCAAGAACAGCCTGAGAGACGAGGGAGTCAAGTTCCTGTGTGAGGCCTTGGGT
NM_176810.2         AATCTGAGCAAGAACAGCCTGAGAGACGAGGGAGTCAAGTTCCTGTGTGAGGCCTTGGGT
XM_005258510.1      AATCTGAGCAAGAACAGCCTGAGAGACGAGGGAGTCAAGTTCCTGTGTGAGGCCTTGGGT
                    ************************************************************

HsCD00082937        CGCCCAGATGGTAACCTGCAGAGCCTGAATTTGTCAGGTTGTTCTTTCACAAGAGAGGGC
NM_176810.2         CGCCCAGATGGTAACCTGCAGAGCCTGAATTTGTCAGGTTGTTCTTTCACAAGAGAGGGC
XM_005258510.1      CGCCCAGATGGTAACCTGCAGAGCCTGAATTTGTCAGGTTGTTCTTTCACAAGAGAGGGC
                    ************************************************************

HsCD00082937        TGTGGAGAGCTGGCTAATGCCCTCAGCCATAATCATAATGTGAAAATCTTGGATTTGGGA
NM_176810.2         TGTGGAGAGCTGGCTAATGCCCTCAGCCATAATCATAATGTGAAAATCTTGGATTTGGGA
XM_005258510.1      TGTGGAGAGCTGGCTAATGCCCTCAGCCATAATCATAATGTGAAAATCTTGGATTTGGGA
                    ************************************************************

HsCD00082937        GAAAATGATCTTCAGGATGATGGAGTGAAGCTACTGTGTGAGGCTCTGAAACCACATCGT
NM_176810.2         GAAAATGATCTTCAGGATGATGGAGTGAAGCTACTGTGTGAGGCTCTGAAACCACATCGT
XM_005258510.1      GAAAATGATCTTCAGGATGATGGAGTGAAGCTACTGTGTGAGGCTCTGAAACCACATCGT
                    ************************************************************

HsCD00082937        GCATTGCACACACTTGGGTTGGCGAAATGCAATCTGACAACTGCTTGCTGCCAGCATCTC
NM_176810.2         GCATTGCACACACTTGGGTTGGCGAAATGCAATCTGACAACTGCTTGCTGCCAGCATCTC
XM_005258510.1      GCATTGCACACACTTGGGTTGGCGAAATGCAATCTGACAACTGCTTGCTGCCAGCATCTC
                    ************************************************************

HsCD00082937        TTCTCTGTTCTCAGCAGCAGTAAGAGCCTGGTCAATCTGAACCTTCTAGGCAATGAATTG
NM_176810.2         TTCTCTGTTCTCAGCAGCAGTAAGAGCCTGGTCAATCTGAACCTTCTAGGCAATGAATTG
XM_005258510.1      TTCTCTGTTCTCAGCAGCAGTAAGAGCCTGGTCAATCTGAACCTTCTAGGCAATGAATTG
                    ************************************************************

HsCD00082937        GATACTGATGGTGTCAAGATGCTATGTAAGGCTTTGAAAAAGTCGACATGCAGGCTGCAG
NM_176810.2         GATACTGATGGTGTCAAGATGCTATGTAAGGCTTTGAAAAAGTCGACATGCAGGCTGCAG
XM_005258510.1      GATACTGATGGTGTCAAGATGCTATGCTTCAAAAAGACCTGCACAATGTAG---------
                    ************************** :: ..:::**..:. :*.* .*.          

HsCD00082937        AAACTCGGGTAA
NM_176810.2         AAACTCGGGTAA
XM_005258510.1      ------------
                                

Protein

SMART domain : LRR_RI : Leucine rich repeat, ribonuclease inhibitor type
UniProt : Q86W25
HPRD : 14804

Clone

Cloning Information : 269814
HIP Master Clone ID : 201316
IMAGE ID : 100015795
Original Clone ID : FLH269814.01X

Organism


TAX_ID : 9606
Species Specific ID: 126204

Genome

Chromosome : 19
Map Location : 19q13.43
Ensembl : ENSG00000173572

Reagents

Labome : NLRP13-antibody