DNASU Plasmid Repository • 480.965.5697 | Email

C6orf11 (Homo sapiens) in pVP16 (His and MBP-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  WDR46
Gene Name:  WD repeat domain 46
Sequence             
Original Clone ID: 1025.1.55_GO.34949
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pVP16               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: His8-MBP fusion prtotein with TEV protease cleavage site is produced; after cleavage the protein obtained will be the translated CDS with the addition of SER at the N-term
Mutation/
Discrepancy :
No / No
Publications: None
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
HsCD00083699

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1907nts         Open reading frame : 28 to 1881
Reference Sequence Alignment

ACAAGTTTGTACAAAAAAGCAGGCTCCGAAAACCTGTACTTCCAGTCCGAGACAGCCCCC
AAGCCGGGCAAGGATGTCCCGCCCAAGAAAGACAAACTTCAGACCAAGAGAAAGAAACCG
CGGCGATACTGGGAGGAAGAGACCGTTCCGACCACAGCCGGAGCCTCTCCAGGGCCTCCT
CGTAACAAGAAGAATCGGGAGCTCCGTCCTCAGAGACCAAAAAATGCTTACATCTTAAAG
AAGTCTCGGATCTCTAAGAAGCCTCAGGTCCCGAAGAAACCCCGAGAATGGAAGAACCCG
GAGTCCCAGCGCGGCTTGTCCGGGGCCCAAGATCCATTCCCAGGCCCCGCCCCCGTCCCT
GTGGAAGTGGTCCAGAAGTTCTGTCGCATTGACAAATCCCGAAAGCTACCACATTCTAAA
GCCAAAACTCGAAGCCGACTTGAGGTGGCTGAAGCTGAGGAAGAGGAAACAAGTATCAAA
GCTGCTCGTTCTGAGCTGCTGCTTGCTGAAGAACCTGGGTTTCTGGAAGGGGAGGATGGG
GAAGACACAGCAAAGATATGCCAGGCTGACATTGTGGAGGCTGTGGACATTGCAAGTGCA
GCCAAGCACTTTGACTTGAATCTGCGGCAGTTTGGACCCTACAGACTAAACTACTCTCGA
ACTGGAAGACACCTGGCTTTTGGAGGGCGCCGAGGTCATGTGGCTGCCCTTGATTGGGTA
ACAAAGAAGCTTATGTGCGAGATCAACGTCATGGAGGCGGTGCGGGACATCCGGTTTCTC
CATTCTGAGGCACTGCTTGCTGTTGCTCAGAACCGCTGGCTCCACATCTATGACAATCAG
GGCATTGAGCTCCACTGTATCCGCCGCTGTGACCGAGTAACACGGCTTGAGTTCCTGCCC
TTCCACTTCCTCCTGGCTACAGCTTCAGAAACAGGGTTTCTAACCTACCTGGATGTGTCA
GTGGGGAAGATTGTGGCAGCTCTGAATGCTCGAGCTGGGCGGCTCGATGTTATGAGTCAG
AACCCTTACAATGCCGTCATCCATCTCGGACACAGCAATGGTACTGTGTCTTTATGGAGT
CCAGCTATGAAGGAGCCACTGGCAAAGATTCTCTGTCATCGTGGTGGGGTCCGGGCTGTG
GCAGTAGATTCTACAGGCACGTACATGGCCACCTCTGGCCTAGACCACCAGCTGAAGATC
TTTGACTTGCGAGGGACGTACCAGCCTCTGAGCACTCGGACCCTGCCCCATGGAGCAGGG
CACCTGGCCTTCTCCCAGAGGGGACTGCTGGTGGCGGGAATGGGTGACGTTGTCAACATC
TGGGCAGGGCAGGGCAAGGCCAGCCCACCCTCCCTTGAACAGCCCTACCTCACCCACCGG
CTCTCAGGCCCTGTGCATGGCCTTCAGTTCTGCCCCTTTGAAGATGTGCTGGGGGTGGGG
CACACTGGGGGCATCACCAGCATGCTGGTCCCTGGGGCCGGTGAGCCCAACTTCGATGGC
CTGGAGAGTAATCCATACAGAAGCCGGAAGCAGCGCCAGGAGTGGGAGGTGAAGGCCCTG
CTAGAGAAGGTACCTGCAGAGCTTATTTGTCTGGACCCACGAGCCCTGGCCGAGGTGGAT
GTCATCTCCCTGGAGCAGGGAAAGAAGGAGCAGATAGAGAGGCTGGGCTATGACCCGCAG
GCTAAGGCTCCCTTCCAGCCAAAGCCAAAGCAGAAGGGCCGCAGCTCCACGGCAAGCCTG
GTGAAGAGGAAGAGGAAGGTCATGGATGAGGAACACAGGGACAAGGTCCGGCAGAGCCTT
CAGCAGCAGCATCATAAGGAGGCGAAGGCCAAGCCCACGGGGGCCCGGCCATCTGCCCTG
GACAGATTTGTGCGCTGATAGGACCCAGCTTTCTTGTACAAAGTGGT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 1
End on reference sequence 1854
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ACAAGTTTGTACAAAAAAGCAGGCTCC

3' Linker Sequence:
TAGGACCCAGCTTTCTTGTACAAAGTGGT

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pVP16

pVP16 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  MBP Forward
Reverse:  pQE Reverse
Description: Bacterial (E. coli) expression, adds N-terminal 8xHis and MBP, adds TEV site on 5p end of insert; ampicillin resistance in bacteria; recombinational cloning; Gateway cloning into this vector will remove the Gateway ccdB death casette.
Comments: TEV protease cleavage site is "partial" and not functional. The TEV cleavage site must be added to the insert by PCR, which allows amino acids encoded by the attB1 site to be cut off after protein expression. Gateway cloning into this vector will remove the Gateway cassette
Size (bp): 7631
Parent Vector: None
Empty Vector: EvNO00084279
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 15750721
Title: Results from high-throughput DNA cloning of Arabidopsis thaliana target genes using site-specific recombination

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 6471 5789
negative selection marker ccdB ccdB death cassette gene (lost in with-insert form) 2643 2852
promoter T5 T5 promoter 5 54
recombination site AttR1 AttR1 recombination site 1316 1440
recombination site AttR2 AttR2 recombination site 3020 2896
repressor protein gene LacI LacI coding region 4132 5211
selectable marker AmpR ampicillin resistance gene 7228 6569
selectable marker CmR chloramphenicol resistance gene (CmR) (Lost in with-insert form) 1549 2205
tag His N-terminal 8xHis tag 128 145
tag MBP N-terminal MBP 148 1246

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : WDR46
Symbol Nomenclature : WDR46
SYNONYM : BING4; C6orf11; FP221; UTP7
Designation : WD repeat-containing protein 46|WD repeat-containing protein BING4
Full Nomenclature : WD repeat domain 46
GENEID : 9277
Locus Tag : DADB-159G18.3
HGNC : 13923
MIM : 611440
Vega : OTTHUMG00000031192
Target GenBank: BC000388

 

Reference Sequence Alignment

  

HsCD00083699        ACAAGTTTGTACAAAAAAGCAGGCTCCGAAAACCTGTACTTCCAGTCCGAGACAGCCCCC
XM_005249481.1      ---------------------------------------------ATGGAGACAGCCCCC
NM_005452.5         ---------------------------------------------ATGGAGACAGCCCCC
XM_005275491.1      ---------------------------------------------ATGGAGACAGCCCCC
XM_005275064.1      ---------------------------------------------ATGGAGACAGCCCCC
XM_005275320.1      ---------------------------------------------ATGGAGACAGCCCCC
XM_005272908.1      ---------------------------------------------ATGGAGACAGCCCCC
                                                                 :  ************

HsCD00083699        AAGCCGGGCAAGGATGTCCCGCCCAAGAAAGACAAACTTCAGACCAAGAGAAAGAAACCG
XM_005249481.1      AAGCCGGGCAAGGATGTCCCGCCCAAGAAAGACAAACTTCAGACCAAGAGAAAGAAACCG
NM_005452.5         AAGCCGGGCAAGGATGTCCCGCCCAAGAAAGACAAACTTCAGACCAAGAGAAAGAAACCG
XM_005275491.1      AAGCCGGGCAAGGATGTCCCGCCCAAGAAAGACAAACTTCAGACCAAGAGAAAGAAACCG
XM_005275064.1      AAGCCGGGCAAGGATGTCCCGCCCAAGAAAGACAAACTTCAGACCAAGAGAAAGAAACCG
XM_005275320.1      AAGCCGGGCAAGGATGTCCCGCCCAAGAAAGACAAACTTCAGACCAAGAGAAAGAAACCG
XM_005272908.1      AAGCCGGGCAAGGATGTCCCGCCCAAGAAAGACAAACTTCAGACCAAGAGAAAGAAACCG
                    ************************************************************

HsCD00083699        CGGCGATACTGGGAGGAAGAGACCGTTCCGACCACAGCCGGAGCCTCTCCAGGGCCTCCT
XM_005249481.1      CGGCGATACTGGGAGGAAGAGACCGTTCCGACCACAGCCGGAGCCTCTCCAGGGCCTCCT
NM_005452.5         CGGCGATACTGGGAGGAAGAGACCGTTCCGACCACAGCCGGAGCCTCTCCAGGGCCTCCT
XM_005275491.1      CGGCGATACTGGGAGGAAGAGACCGTTCCGACCACAGCCGGAGCCTCTCCAGGGCCTCCT
XM_005275064.1      CGGCGATACTGGGAGGAAGAGACCGTTCCGACCACAGCCGGAGCCTCTCCAGGGCCTCCT
XM_005275320.1      CGGCGATACTGGGAGGAAGAGACCGTTCCGACCACAGCCGGAGCCTCTCCAGGGCCTCCT
XM_005272908.1      CGGCGATACTGGGAGGAAGAGACCGTTCCGACCACAGCCGGAGCCTCTCCAGGGCCTCCT
                    ************************************************************

HsCD00083699        CGTAACAAGAAGAATCGGGAGCTCCGTCCTCAGAGACCAAAAAATGCTTACATCTTAAAG
XM_005249481.1      CGTAACAAGAAGAATCGGGAGCTCCGTCCTCAGAGACCAAAAAATGCTTACATCTTAAAG
NM_005452.5         CGTAACAAGAAGAATCGGGAGCTCCGTCCTCAGAGACCAAAAAATGCTTACATCTTAAAG
XM_005275491.1      CGTAACAAGAAGAATCGGGAGCTCCGTCCTCAGAGACCAAAAAATGCTTACATCTTAAAG
XM_005275064.1      CGTAACAAGAAGAATCGGGAGCTCCGTCCTCAGAGACCAAAAAATGCTTACATCTTAAAG
XM_005275320.1      CGTAACAAGAAGAATCGGGAGCTCCGTCCTCAGAGACCAAAAAATGCTTACATCTTAAAG
XM_005272908.1      CGTAACAAGAAGAATCGGGAGCTCCGTCCTCAGAGACCAAAAAATGCTTACATCTTAAAG
                    ************************************************************

HsCD00083699        AAGTCTCGGATCTCTAAGAAGCCTCAGGTCCCGAAGAAACCCCGAGAATGGAAGAACCCG
XM_005249481.1      AAGTCTCGGATCTCTAAGAAGCCTCAGGTCCCGAAGAAACCCCGAGAATGGAAGAACCCG
NM_005452.5         AAGTCTCGGATCTCTAAGAAGCCTCAGGTCCCGAAGAAACCCCGAGAATGGAAGAACCCG
XM_005275491.1      AAGTCTCGGATCTCTAAGAAGCCTCAGGTCCCGAAGAAACCCCGAGAATGGAAGAACCCG
XM_005275064.1      AAGTCTCGGATCTCTAAGAAGCCTCAGGTCCCGAAGAAACCCCGAGAATGGAAGAACCCG
XM_005275320.1      AAGTCTCGGATCTCTAAGAAGCCTCAGGTCCCGAAGAAACCCCGAGAATGGAAGAACCCG
XM_005272908.1      AAGTCTCGGATCTCTAAGAAGCCTCAGGTCCCGAAGAAACCCCGAGAATGGAAGAACCCG
                    ************************************************************

HsCD00083699        GAGTCCCAGCGCGGCTTGTCCGGGGCCCAAGATCCATTCCCAGGCCCCGCCCCCGTCCCT
XM_005249481.1      GAGTCCCAGCGCGGCTTGTCCGGGACCCAAGATCCATTCCCAGGCCCCGCCCCCGTCCCT
NM_005452.5         GAGTCCCAGCGCGGCTTGTCCGGGACCCAAGATCCATTCCCAGGCCCCGCCCCCGTCCCT
XM_005275491.1      GAGTCCCAGCGCGGCTTGTCCGGGGCCCAAGATCCATTCCCAGGCCCCGCCCCCGTCCCT
XM_005275064.1      GAGTCCCAGCGCGGCTTGTCCGGGGCCCAAGATCCATTCCCAGGCCCCGCCCCCGTCCCT
XM_005275320.1      GAGTCCCAGCGCGGCTTGTCCGGGGCCCAAGATCCATTCCCAGGCCCCGCCCCCGTCCCT
XM_005272908.1      GAGTCCCAGCGCGGCTTGTCCGGGGCCCAAGATCCATTCCCAGGCCCCGCCCCCGTCCCT
                    ************************.***********************************

HsCD00083699        GTGGAAGTGGTCCAGAAGTTCTGTCGCATTGACAAATCCCGAAAGCTACCACATTCTAAA
XM_005249481.1      GTGGAAGTGGTCCAGAAGTTCTGTCGCATTGACAAATCCCGAAAGCTACCACATTCTAAA
NM_005452.5         GTGGAAGTGGTCCAGAAGTTCTGTCGCATTGACAAATCCCGAAAGCTACCACATTCTAAA
XM_005275491.1      GTGGAAGTGGTCCAGAAGTTCTGTCGCATTGACAAATCTCGAAAGCTACCACATTCTAAA
XM_005275064.1      GTGGAAGTGGTCCAGAAGTTCTGTCGCATTGACAAATCCCGAAAGCTACCACATTCTAAA
XM_005275320.1      GTGGAAGTGGTCCAGAAGTTCTGTCGCATTGACAAATCCCGAAAGCTACCACATTCTAAA
XM_005272908.1      GTGGAAGTGGTCCAGAAGTTCTGTCGCATTGACAAATCCCGAAAGCTACCACATTCTAAA
                    ************************************** *********************

HsCD00083699        GCCAAAACTCGAAGCCGACTTGAGGTGGCTGAAGCTGAGGAAGAGGAAACAAGTATCAAA
XM_005249481.1      GCCAAAACTCGAAGCCGACTTGAGGTGGCTGAAGCTGAGGAAGAGGAAACAAGTATCAAA
NM_005452.5         GCCAAAACTCGAAGCCGACTTGAGGTGGCTGAAGCTGAGGAAGAGGAAACAAGTATCAAA
XM_005275491.1      GCCAAAACTCGAAGCCGACTTGAGGTGGCTGAAGCTGAGGAAGAGGAAACAAGTATCAAA
XM_005275064.1      GCCAAAACTCGAAGCCGACTTGAGGTGGCTGAAGCTGAGGAAGAGGAAACAAGTATCAAA
XM_005275320.1      GCCAAAACTCGAAGCCGACTTGAGGTGGCTGAAGCTGAGGAAGAGGAAACAAGTATCAAA
XM_005272908.1      GCCAAAACTCGAAGCCGACTTGAGGTGGCTGAAGCTGAGGAAGAGGAAACAAGTATCAAA
                    ************************************************************

HsCD00083699        GCTGCTCGTTCTGAGCTGCTGCTTGCTGAAGAACCTGGGTTTCTGGAAGGGGAGGATGGG
XM_005249481.1      GCTGCTCGTTCTGAGCTGCTGCTTGCTGAAGAACCTGGGTTTCTGGAAGGGGAGGATGGG
NM_005452.5         GCTGCTCGTTCTGAGCTGCTGCTTGCTGAAGAACCTGGGTTTCTGGAAGGGGAGGATGGG
XM_005275491.1      GCTGCTCGTTCTGAGCTGCTGCTTGCTGAAGAACCTGGGTTTCTGGAAGGGGAGGATGGG
XM_005275064.1      GCTGCTCGTTCTGAGCTGCTGCTTGCTGAAGAACCTGGGTTTCTGGAAGGGGAGGATGGG
XM_005275320.1      GCTGCTCGTTCTGAGCTGCTGCTTGCTGAAGAACCTGGGTTTCTGGAAGGGGAGGATGGG
XM_005272908.1      GCTGCTCGTTCTGAGCTGCTGCTTGCTGAAGAACCTGGGTTTCTGGAAGGGGAGGATGGG
                    ************************************************************

HsCD00083699        GAAGACACAGCAAAGATATGCCAGGCTGACATTGTGGAGGCTGTGGACATTGCAAGTGCA
XM_005249481.1      GAAGACACAGCAAAGATATGCCAGGCTGACATTGTGGAGGCTGTGGACATTGCAAGTGCA
NM_005452.5         GAAGACACAGCAAAGATATGCCAGGCTGACATTGTGGAGGCTGTGGACATTGCAAGTGCA
XM_005275491.1      GAAGACACAGCAAAGATATGCCAGGCTGACATTGTGGAGGCTGTGGACATTGCAAGTGCA
XM_005275064.1      GAAGACACAGCAAAGATATGCCAGGCTGACATTGTGGAGGCTGTGGACATTGCAAGTGCA
XM_005275320.1      GAAGACACAGCAAAGATATGCCAGGCTGACATTGTGGAGGCTGTGGACATTGCAAGTGCA
XM_005272908.1      GAAGACACAGCAAAGATATGCCAGGCTGACATTGTGGAGGCTGTGGACATTGCAAGTGCA
                    ************************************************************

HsCD00083699        GCCAAGCACTTTGACTTGAATCTGCGGCAGTTTGGACCCTACAGACTAAACTACTCTCGA
XM_005249481.1      GCCAAGCACTTTGACTTGAATCTGCGGCAGTTTGGACCCTACAGACTAAACTACTCTCGA
NM_005452.5         GCCAAGCACTTTGACTTGAATCTGCGGCAGTTTGGACCCTACAGACTAAACTACTCTCGA
XM_005275491.1      GCCAAGCACTTTGACTTGAATCTGCGGCAGTTTGGACCCTACAGACTAAACTACTCTCGA
XM_005275064.1      GCCAAGCACTTTGACTTGAATCTGCGGCAGTTTGGACCCTACAGACTAAACTACTCTCGA
XM_005275320.1      GCCAAGCACTTTGACTTGAATCTGCGGCAGTTTGGACCCTACAGACTAAACTACTCTCGA
XM_005272908.1      GCCAAGCACTTTGACTTGAATCTGCGGCAGTTTGGACCCTACAGACTAAACTACTCTCGA
                    ************************************************************

HsCD00083699        ACTGGAAGACACCTGGCTTTTGGAGGGCGCCGAGGTCATGTGGCTGCCCTTGATTGGGTA
XM_005249481.1      ACTGGAAGACACCTGGCTTTTGGAGGGCGCCGAGGTCATGTGGCTGCCCTTGATTGGGTA
NM_005452.5         ACTGGAAGACACCTGGCTTTTGGAGGGCGCCGAGGTCATGTGGCTGCCCTTGATTGGGTA
XM_005275491.1      ACTGGAAGACACCTGGCTTTTGGAGGGCGCCGAGGTCATGTGGCTGCCCTTGATTGGGTA
XM_005275064.1      ACTGGAAGACACCTGGCTTTTGGAGGGCGCCGAGGTCATGTGGCTGCCCTTGATTGGGTA
XM_005275320.1      ACTGGAAGACACCTGGCTTTTGGAGGGCGCCGAGGTCATGTGGCTGCCCTTGATTGGGTA
XM_005272908.1      ACTGGAAGACACCTGGCTTTTGGAGGGCGCCGAGGTCATGTGGCTGCCCTTGATTGGGTA
                    ************************************************************

HsCD00083699        ACAAAGAAGCTTATGTGCGAGATCAACGTCATGGAGGCGGTGCGGGACATCCGGTTTCTC
XM_005249481.1      ACAAAGAAGCTTATGTGCGAGATCAACGTCATGGAGGCGGTGCGGGACATCCGGTTTCTC
NM_005452.5         ACAAAGAAGCTTATGTGCGAGATCAACGTCATGGAGGCGGTGCGGGACATCCGGTTTCTC
XM_005275491.1      ACAAAGAAGCTTATGTGCGAGATCAACGTCATGGAGGCGGTGCGGGACATCCGGTTTCTC
XM_005275064.1      ACAAAGAAGCTTATGTGCGAGATCAACGTCATGGAGGCGGTGCGGGACATCCGGTTTCTC
XM_005275320.1      ACAAAGAAGCTTATGTGCGAGATCAACGTCATGGAGGCGGTGCGGGACATCCGGTTTCTC
XM_005272908.1      ACAAAGAAGCTTATGTGCGAGATCAACGTCATGGAGGCGGTGCGGGACATCCGGTTTCTC
                    ************************************************************

HsCD00083699        CATTCTGAGGCACTGCTTGCTGTTGCTCAGAACCGCTGGCTCCACATCTATGACAATCAG
XM_005249481.1      CATTCTGAGGCACTGCTTGCTGTTGCTCAGAACCGCTGGCTCCACATCTATGACAATCAG
NM_005452.5         CATTCTGAGGCACTGCTTGCTGTTGCTCAGAACCGCTGGCTCCACATCTATGACAATCAG
XM_005275491.1      CATTCTGAGGCACTGCTTGCTGTTGCTCAGAACCGCTGGCTCCACATCTATGACAATCAG
XM_005275064.1      CATTCTGAGGCACTGCTTGCTGTTGCTCAGAACCGCTGGCTCCACATCTATGACAATCAG
XM_005275320.1      CATTCTGAGGCACTGCTTGCTGTTGCTCAGAACCGCTGGCTCCACATCTATGACAATCAG
XM_005272908.1      CATTCTGAGGCACTGCTTGCTGTTGCTCAGAACCGCTGGCTCCACATCTATGACAATCAG
                    ************************************************************

HsCD00083699        GGCATTGAGCTCCACTGTATCCGCCGCTGTGACCGAGTAACACGGCTTGAGTTCCTGCCC
XM_005249481.1      GGCATTGAGCTCCACTGTATCCGCCGCTGTGACCGAGTAACACGGCTTGAGTTCCTGCCC
NM_005452.5         GGCATTGAGCTCCACTGTATCCGCCGCTGTGACCGAGTAACACGGCTTGAGTTCCTGCCC
XM_005275491.1      GGCATTGAGCTCCACTGTATCCGCCGCTGTGACCGAGTAACACGGCTTGAGTTCCTGCCC
XM_005275064.1      GGCATTGAGCTCCACTGTATCCGCCGCTGTGACCGAGTAACACGGCTTGAGTTCCTGCCC
XM_005275320.1      GGCATTGAGCTCCACTGTATCCGCCGCTGTGACCGAGTAACACGGCTTGAGTTCCTGCCC
XM_005272908.1      GGCATTGAGCTCCACTGTATCCGCCGCTGTGACCGAGTAACACGGCTTGAGTTCCTGCCC
                    ************************************************************

HsCD00083699        TTCCACTTCCTCCTGGCTACAGCTTCAGAAACAGGGTTTCTAACCTACCTGGATGTGTCA
XM_005249481.1      TTCCACTTCCTCCTGGCTACAGCTTCAGAAACAGGGTTTCTAACCTACCTGGATGTGTCA
NM_005452.5         TTCCACTTCCTCCTGGCTACAGCTTCAGAAACAGGGTTTCTAACCTACCTGGATGTGTCA
XM_005275491.1      TTCCACTTCCTCCTGGCTACAGCTTCAGAAACAGGGTTTCTAACCTACCTGGATGTGTCA
XM_005275064.1      TTCCACTTCCTCCTGGCTACAGCTTCAGAAACAGGGTTTCTAACCTACCTGGATGTGTCA
XM_005275320.1      TTCCACTTCCTCCTGGCTACAGCTTCAGAAACAGGGTTTCTAACCTACCTGGATGTGTCA
XM_005272908.1      TTCCACTTCCTCCTGGCTACAGCTTCAGAAACAGGGTTTCTAACCTACCTGGATGTGTCA
                    ************************************************************

HsCD00083699        GTGGGGAAGATTGTGGCAGCTCTGAATGCTCGAGCTGGGCGGCTCGATGTTATGAGTCAG
XM_005249481.1      GTGGGGAAGATTGTGGCAGCTCTGAATGCTCGAGCTGGGCGGCTCGATGTTATGAGTCAG
NM_005452.5         GTGGGGAAGATTGTGGCAGCTCTGAATGCTCGAGCTGGGCGGCTCGATGTTATGAGTCAG
XM_005275491.1      GTGGGGAAGATTGTGGCAGCTCTGAATGCTCGAGCTGGGCGGCTCGATGTTATGAGTCAG
XM_005275064.1      GTGGGGAAGATTGTGGCAGCTCTGAATGCTCGAGCTGGGCGGCTCGATGTTATGAGTCAG
XM_005275320.1      GTGGGGAAGATTGTGGCAGCTCTGAATGCTCGAGCTGGGCGGCTCGATGTTATGAGTCAG
XM_005272908.1      GTGGGGAAGATTGTGGCAGCTCTGAATGCTCGAGCTGGGCGGCTCGATGTTATGAGTCAG
                    ************************************************************

HsCD00083699        AACCCTTACAATGCCGTCATCCATCTCGGACACAGCAATGGTACTGTGTCTTTATGGAGT
XM_005249481.1      AACCCTTACAATGCCGTCATCCATCTCGGACACAGCAATGGTACTGTGTCTTTATGGAGT
NM_005452.5         AACCCTTACAATGCCGTCATCCATCTCGGACACAGCAATGGTACTGTGTCTTTATGGAGT
XM_005275491.1      AACCCTTACAATGCCGTCATCCATCTCGGACACAGCAATGGTACTGCGTCTTTATGGAGT
XM_005275064.1      AACCCTTACAATGCCGTCATCCATCTCGGACACAGCAATGGTACTGTGTCTTTATGGAGT
XM_005275320.1      AACCCTTACAATGCCGTCATCCATCTCGGACACAGCAATGGTACTGTGTCTTTATGGAGT
XM_005272908.1      AACCCTTACAATGCCGTCATCCATCTCGGACACAGCAATGGTACTGTGTCTTTATGGAGT
                    ********************************************** *************

HsCD00083699        CCAGCTATGAAGGAGCCACTGGCAAAGATTCTCTGTCATCGTGGTGGGGTCCGGGCTGTG
XM_005249481.1      CCAGCTATGAAGGAGCCACTGGCAAAGATTCTCTGTCATCGTGGTGGGGTCCGGGCTGTG
NM_005452.5         CCAGCTATGAAGGAGCCACTGGCAAAGATTCTCTGTCATCGTGGTGGGGTCCGGGCTGTG
XM_005275491.1      CCAGCTATGAAGGAGCCACTGGCAAAGATTCTCTGTCATCGTGGTGGGGTCCGGGCTGTG
XM_005275064.1      CCAGCTATGAAGGAGCCACTGGCAAAGATTCTCTGTCATCGTGGTGGGGTCCGGGCTGTG
XM_005275320.1      CCAGCTATGAAGGAGCCACTGGCAAAGATTCTCTGTCATCGTGGTGGGGTCCGGGCTGTG
XM_005272908.1      CCAGCTATGAAGGAGCCACTGGCAAAGATTCTCTGTCATCGTGGTGGGGTCCGGGCTGTG
                    ************************************************************

HsCD00083699        GCAGTAGATTCTACAGGCACGTACATGGCCACCTCTGGCCTAGACCACCAGCTGAAGATC
XM_005249481.1      GCAGTAGATTCTACAGGCACGTACATGGCCACCTCTGGCCTAGACCACCAGCTGAAGATC
NM_005452.5         GCAGTAGATTCTACAGGCACGTACATGGCCACCTCTGGCCTAGACCACCAGCTGAAGATC
XM_005275491.1      GCAGTAGATTCTACAGGCACGTACATGGCCACCTCTGGCCTAGACCACCAGCTGAAGATC
XM_005275064.1      GCAGTAGATTCTACAGGCACGTACATGGCCACCTCTGGCCTAGACCACCAGCTGAAGATC
XM_005275320.1      GCAGTAGATTCTACAGGCACGTACATGGCCACCTCTGGCCTAGACCACCAGCTGAAGATC
XM_005272908.1      GCAGTAGATTCTACAGGCACGTACATGGCCACCTCTGGCCTAGACCACCAGCTGAAGATC
                    ************************************************************

HsCD00083699        TTTGACTTGCGAGGGACGTACCAGCCTCTGAGCACTCGGACCCTGCCCCATGGAGCAGGG
XM_005249481.1      TTTGACTTGCGAGGGACGTACCAGCCTCTGAGCACTCGGACCCTGCCCCATGGAGCAGGG
NM_005452.5         TTTGACTTGCGAGGGACGTACCAGCCTCTGAGCACTCGGACCCTGCCCCATGGAGCAGGG
XM_005275491.1      TTTGACTTGCGAGGGACGTACCAGCCTCTGAGCACTCGGACCCTGCCCCATGGAGCAGGG
XM_005275064.1      TTTGACTTGCGAGGGACGTACCAGCCTCTGAGCACTCGGACCCTGCCCCATGGAGCAGGG
XM_005275320.1      TTTGACTTGCGAGGGACGTACCAGCCTCTGAGCACTCGGACCCTGCCCCATGGAGCAGGG
XM_005272908.1      TTTGACTTGCGAGGGACGTACCAGCCTCTGAGCACTCGGACCCTGCCCCATGGAGCAGGG
                    ************************************************************

HsCD00083699        CACCTGGCCTTCTCCCAGAGGGGACTGCTGGTGGCGGGAATGGGTGACGTTGTCAACATC
XM_005249481.1      CACCTGGCCTTCTCCCAGAGGGGACTGCTGGTGGCGGGAATGGGTGACGTTGTCAACATC
NM_005452.5         CACCTGGCCTTCTCCCAGAGGGGACTGCTGGTGGCGGGAATGGGTGACGTTGTCAACATC
XM_005275491.1      CACCTGGCCTTCTCCCAGAGGGGACTGCTGGTGGCGGGAATGGGTGACGTTGTCAACATC
XM_005275064.1      CACCTGGCCTTCTCCCAGAGGGGACTGCTGGTGGCGGGAATGGGTGACGTTGTCAACATC
XM_005275320.1      CACCTGGCCTTCTCCCAGAGGGGACTGCTGGTGGCGGGAATGGGTGACGTTGTCAACATC
XM_005272908.1      CACCTGGCCTTCTCCCAGAGGGGACTGCTGGTGGCGGGAATGGGTGACGTTGTCAACATC
                    ************************************************************

HsCD00083699        TGGGCAGGGCAGGGCAAGGCCAGCCCACCCTCCCTTGAACAGCCCTACCTCACCCACCGG
XM_005249481.1      TGGGCAGGGCAGGGCAAGGCCAGCCCACCCTCCCTTGAACAGCCCTACCTCACCCACCGG
NM_005452.5         TGGGCAGGGCAGGGCAAGGCCAGCCCACCCTCCCTTGAACAGCCCTACCTCACCCACCGG
XM_005275491.1      TGGGCAGGGCAGGGCAAGGCCAGCCCACCCTCCCTTGAACAGCCCTACCTCACCCACCGG
XM_005275064.1      TGGGCAGGGCAGGGCAAGGCCAGCCCACCCTCCCTTGAACAGCCCTACCTCACCCACCGG
XM_005275320.1      TGGGCAGGGCAGGGCAAGGCCAGCCCACCCTCCCTTGAACAGCCCTACCTCACCCACCGG
XM_005272908.1      TGGGCAGGGCAGGGCAAGGCCAGCCCACCCTCCCTTGAACAGCCCTACCTCACCCACCGG
                    ************************************************************

HsCD00083699        CTCTCAGGCCCTGTGCATGGCCTTCAGTTCTGCCCCTTTGAAGATGTGCTGGGGGTGGGG
XM_005249481.1      CTCTCAGGCCCTGTGCATGGCCTTCAGTTCTGCCCCTTTGAAGATGTGCTGGGGGTGGGG
NM_005452.5         CTCTCAGGCCCTGTGCATGGCCTTCAGTTCTGCCCCTTTGAAGATGTGCTGGGGGTGGGG
XM_005275491.1      CTCTCAGGCCCTGTGCATGGCCTTCAGTTCTGCCCCTTTGAAGATGTGCTGGGGGTGGGG
XM_005275064.1      CTCTCAGGCCCTGTGCATGGCCTTCAGTTCTGCCCCTTTGAAGATGTGCTGGGGGTGGGG
XM_005275320.1      CTCTCAGGCCCTGTGCATGGCCTTCAGTTCTGCCCCTTTGAAGATGTGCTGGGGGTGGGG
XM_005272908.1      CTCTCAGGCCCTGTGCATGGCCTTCAGTTCTGCCCCTTTGAAGATGTGCTGGGGGTGGGG
                    ************************************************************

HsCD00083699        CACACTGGGGGCATCACCAGCATGCTGGTCCCTGGGGCCGGTGAGCCCAACTTCGATGGC
XM_005249481.1      CACACTGGGGGCATCACCAGCATGCTGGTCCCTGGGGCCGGTGAGCCCAACTTCGATGGC
NM_005452.5         CACACTGGGGGCATCACCAGCATGCTGGTCCCTGGGGCCGGTGAGCCCAACTTCGATGGC
XM_005275491.1      CACACTGGGGGCATCACCAGCATGCTGGTCCCTGGGGCCGGTGAGCCCAACTTCGATGGC
XM_005275064.1      CACACTGGGGGCATCACCAGCATGCTGGTCCCTGGGGCCGGTGAGCCCAACTTCGATGGC
XM_005275320.1      CACACTGGGGGCATCACCAGCATGCTGGTCCCTGGGGCCGGTGAGCCCAACTTCGATGGC
XM_005272908.1      CACACTGGGGGCATCACCAGCATGCTGGTCCCTGGGGCCGGTGAGCCCAACTTCGATGGC
                    ************************************************************

HsCD00083699        CTGGAGAGTAATCCATACAGAAGCCGGAAGCAGCGCCAGGAGTGGGAGGTGAAGGCCCTG
XM_005249481.1      CTGGAGAGTAATCCATACAGAAGCCGGAAGCAGCGCCAGGAGTGGGAGGTGAAGGCCCTG
NM_005452.5         CTGGAGAGTAATCCATACAGAAGCCGGAAGCAGCGCCAGGAGTGGGAGGTGAAGGCCCTG
XM_005275491.1      CTGGAGAGTAATCCATACAGAAGCCGGAAGCAGCGCCAGGAGTGGGAGGTGAAGGCCCTG
XM_005275064.1      CTGGAGAGTAATCCATACAGAAGCCGGAAGCAGCGCCAGGAGTGGGAGGTGAAGGCCCTG
XM_005275320.1      CTGGAGAGTAATCCATACAGAAGCCGGAAGCAGCGCCAGGAGTGGGAGGTGAAGGCCCTG
XM_005272908.1      CTGGAGAGTAATCCATACAGAAGCCGGAAGCAGCGCCAGGAGTGGGAGGTGAAGGCCCTG
                    ************************************************************

HsCD00083699        CTAGAGAAGGTACCTGCAGAGCTTATTTGTCTGGACCCACGAGCCCTGGCCGAGGTGGAT
XM_005249481.1      CTAGAGAAGGTACCTGCAGAGCTTATTTGTCTGGACCCACGAGCCCTGGCCGAGGTGGAT
NM_005452.5         CTAGAGAAGGTACCTGCAGAGCTTATTTGTCTGGACCCACGAGCCCTGGCCGAGGTGGAT
XM_005275491.1      CTAGAGAAGGTACCTGCAGAGCTTATTTGTCTGGACCCACGAGCCCTGGCCGAGGTGGAT
XM_005275064.1      CTAGAGAAGGTACCTGCAGAGCTTATTTGTCTGGACCCACGAGCCCTGGCCGAGGTGGAT
XM_005275320.1      CTAGAGAAGGTACCTGCAGAGCTTATTTGTCTGGACCCACGAGCCCTGGCCGAGGTGGAT
XM_005272908.1      CTAGAGAAGGTACCTGCAGAGCTTATTTGTCTGGACCCACGAGCCCTGGCCGAGGTGGAT
                    ************************************************************

HsCD00083699        GTCATCTCCCTGGAGCAGGGAAAGAAGGAGCAGATAGAGAGGCTGGGCTATGACCCGCAG
XM_005249481.1      GTCATCTCCCTGGAGCAGGGAAAGAAGGAGCAGATAGAGAGGCTGGGCTATGACCCGCAG
NM_005452.5         GTCATCTCCCTGGAGCAGGGAAAGAAGGAGCAGATAGAGAGGCTGGGCTATGACCCGCAG
XM_005275491.1      GTCATCTCCCTGGAGCAGGGAAAGAAGGAGCAGATAGAGAGGCTGGGCTATGACCCGCAG
XM_005275064.1      GTCATCTCCCTGGAGCAGGGAAAGAAGGAGCAGATAGAGAGGCTGGGCTATGACCCGCAG
XM_005275320.1      GTCATCTCCCTGGAGCAGGGAAAGAAGGAGCAGATAGAGAGGCTGGGCTATGACCCGCAG
XM_005272908.1      GTCATCTCCCTGGAGCAGGGAAAGAAGGAGCAGATAGAGAGGCTGGGCTATGACCCGCAG
                    ************************************************************

HsCD00083699        GCTAAGGCTCCCTTCCAGCCAAAGCCAAAGCAGAAGGGCCGCAGCTCCACGGCAAGCCTG
XM_005249481.1      GCTAAGGCTCCCTTCCAGCCAAAGCCAAAGCAGAAGGGCCGCAGCTCCACGGCAAGCCTG
NM_005452.5         GCTAAGGCTCCCTTCCAGCCAAAGCCAAAGCAGAAGGGCCGCAGCTCCACGGCAAGCCTG
XM_005275491.1      GCTAAGGCTCCCTTCCAGCCAAAGCCAAAGCAGAAGGGCCGCAGCTCCACGGCAAGCCTG
XM_005275064.1      GCTAAGGCTCCCTTCCAGCCAAAGCCAAAGCAGAAGGGCCGCAGCTCCACGGCAAGCCTG
XM_005275320.1      GCTAAGGCTCCCTTCCAGCCAAAGCCAAAGCAGAAGGGCCGCAGCTCCACGGCAAGCCTG
XM_005272908.1      GCTAAGGCTCCCTTCCAGCCAAAGCCAAAGCAGAAGGGCCGCAGCTCCACGGCAAGCCTG
                    ************************************************************

HsCD00083699        GTGAAGAGGAAGAGGAAGGTCATGGATGAGGAACACAGG---------------------
XM_005249481.1      GTGAAGAGGAAGAGGAAGGTCATGGATGAGGAACACAGGGTAAATGAGCATTGGCATGGG
NM_005452.5         GTGAAGAGGAAGAGGAAGGTCATGGATGAGGAACACAGG---------------------
XM_005275491.1      GTGAAGAGGAAGAGGAAGGTCATGGATGAGGAACACAGGGTAAATGAGCATTGGCATGGG
XM_005275064.1      GTGAAGAGGAAGAGGAAGGTCATGGATGAGGAACACAGGGTAAATGAGCATTGGCATGGG
XM_005275320.1      GTGAAGAGGAAGAGGAAGGTCATGGATGAGGAACACAGGGTAAATGAGCATTGGCATGGG
XM_005272908.1      GTGAAGAGGAAGAGGAAGGTCATGGATGAGGAACACAGGGTAAATGAGCATTGGCATGGG
                    ***************************************                     

HsCD00083699        ------------------------------------------------------------
XM_005249481.1      CCGGGCCTTCCACAGGCTGCACCCTCCTGCTTGTGCCTCTGCCCTTGTCAGCCTGCCACT
NM_005452.5         ------------------------------------------------------------
XM_005275491.1      CCGGGCCTTCCACAGGCTGCACCCTCCTGCTTGTGCCTCTGCCCTTGTCAGCCTGCCACT
XM_005275064.1      CCGGGCCTTCCACAGGCTGCACCCTCCTGCTTGTGCCTCTGCCCTTGTCAGCCTGCCACT
XM_005275320.1      CCGGGCCTTCCACAGGCTGCACCCTCCTGCTTGTGCCTCTGCCCTTGTCAGCCTGCCACT
XM_005272908.1      CCGGGCCTTCCACAGGCTGCACCCTCCTGCTTGTGCCTCTGCCCTTGTCAGCCTGCCACT
                                                                                

HsCD00083699        -----------------------------------------GACAAGGTCCGGCAGAGCC
XM_005249481.1      TCTCACTCTGTGCCTGTGTCCTCCCCGTCTCCGGTCCCCAGGACAAGGTCCGGCAGAGCC
NM_005452.5         -----------------------------------------GACAAGGTCCGGCAGAGCC
XM_005275491.1      TCTCACTCTGTGCCTGTGTCCTCCCCGTCTCCGGTCCCCAGGACAAGGTCCGGCAGAGCC
XM_005275064.1      TCTCACTCTGTGCCTGTGTCCTCCCCGTCTCCGGTCCCCAGGACAAGGTCCGGCAGAGCC
XM_005275320.1      TCTCACTCTGTGCCTGTGTCCTCCCCGTCTCCGGTCCCCAGGACAAGGTCCGGCAGAGCC
XM_005272908.1      TCTCACTCTGTGCCTGTGTCCTCCCCGTCTCCGGTCCCCAGGACAAGGTCCGGCAGAGCC
                                                             *******************

HsCD00083699        TTCAGCAGCAGCATCATAAGGAGGCGAAGGCCAAGCCCACGGGGGCCCGGCCATCTGCCC
XM_005249481.1      TTCAGCAGCAGCATCATAAGGAGGCGAAGGCCAAGCCCACGGGGGCCCGGCCATCTGCCC
NM_005452.5         TTCAGCAGCAGCATCATAAGGAGGCGAAGGCCAAGCCCACGGGGGCCCGGCCATCTGCCC
XM_005275491.1      TTCAGCAGCAGCATCATAAGGAGGCGAAGGCCAAGCCCACGGGGGCCCGGCCATCTGCCC
XM_005275064.1      TTCAGCAGCAGCATCATAAGGAGGCGAAGGCCAAGCCCACGGGGGCCCGGCCATCTGCCC
XM_005275320.1      TTCAGCAGCAGCATCATAAGGAGGCGAAGGCCAAGCCCACGGGGGCCCGGCCATCTGCCC
XM_005272908.1      TTCAGCAGCAGCATCATAAGGAGGCGAAGGCCAAGCCCACGGGGGCCCGGCCATCTGCCC
                    ************************************************************

HsCD00083699        TGGACAGATTTGTGCGCTGATAGGACCCAGCTTTCTTGTACAAAGTGGT-----------
XM_005249481.1      TGGACAGATTTGTGCGCTGAGCCAGACTCCAGGGTTGCCTGGGAACAGTCTCTCCCCAAG
NM_005452.5         TGGACAGATTTGTGCGCTGA----------------------------------------
XM_005275491.1      TGGACAGATTTGTGCGCTGAGCCAGACTCCAGGGTTGCCTGGGAACAGTCTCTCCCCAAG
XM_005275064.1      TGGACAGATTTGTGCGCTGAGCCAGACTCCAGGGTTGCCTGGGAACAGTCTCTCCCCAAG
XM_005275320.1      TGGACAGATTTGTGCGCTGAGCCAGACTCCAGGGTTGCCTGGGAACAGTCTCTCCCCAAG
XM_005272908.1      TGGACAGATTTGTGCGCTGAGCCAGACTCCAGGGTTGCCTGGGAACAGTCTCTCCCCAAG
                    ********************                                        

HsCD00083699        ------------------------------------------------------------
XM_005249481.1      ATCACCTGTAGGGAAATGAGTGTTCCCTGGAACAAGGAGGTGGGGGCAGTGTGGCCCCTT
NM_005452.5         ------------------------------------------------------------
XM_005275491.1      ATCACCTGTAGGGAAATGAGTGTTCCCTGGAACAAGGAGGTGGGGGCAGTGTGGCCCCTT
XM_005275064.1      ATCACCTGTAGGGAAATGAGTGTTCCCTGGAACAAGGAGGTGGGGGCAGTGTGGCCCCTT
XM_005275320.1      ATCACCTGTAGGGAAATGAGTGTTCCCTGGAACAAGGAGGTGGGGGCAGTGTGGCCCCTT
XM_005272908.1      ATCACCTGTAGGGAAATGAGTGTTCCCTGGAACAAGGAGGTGGGGGCAGTGTGGCCCCTT
                                                                                

HsCD00083699        ------------------------------------------------------------
XM_005249481.1      CCCCAACTGGGGGTGGACAGCTGTCTCCTGGGGTGGGTTGGTATTAAAGAGGAAAGCGAT
NM_005452.5         ------------------------------------------------------------
XM_005275491.1      CCCCAACTGGGGGTGGACAGCTGTCTCCTGGGGTGGGTTGGTATTAAAGAGGAAAGCGAT
XM_005275064.1      CCCCAACTGGGGGTGGACAGCTGTCTCCTGGGGTGGGTTGGTATTAAAGAGGAAAGCGAT
XM_005275320.1      CCCCAACTGGGGGTGGACAGCTGTCTCCTGGGGTGGGTTGGTATTAAAGAGGAAAGCGAT
XM_005272908.1      CCCCAACTGGGGGTGGACAGCTGTCTCCTGGGGTGGGTTGGTATTAAAGAGGAAAGCGAT
                                                                                

HsCD00083699        ------------------------------------------------------------
XM_005249481.1      TTTTTGGATAATGTGTCTGGATCATCTTGTGGACCTGTTCCCCTCCCCCTTGCCAAGCAT
NM_005452.5         ------------------------------------------------------------
XM_005275491.1      TTTTTGGATAATGTGTCTGGATCATCTTGTGGACCTGTTCCCCTCCCCCTTGCCAAGCAT
XM_005275064.1      TTTTTGGATAATGTGTCTGGATCATCTTGTGGACCTGTTCCCCTCCCCCTTGCCAAGCAT
XM_005275320.1      TTTTTGGATAATGTGTCTGGATCATCTTGTGGACCTGTTCCCCTCCCCCTTGCCAAGCAT
XM_005272908.1      TTTTTGGATAATGTGTCTGGATCATCTTGTGGACCTGTTCCCCTCCCCCTTGCCAAGCAT
                                                                                

HsCD00083699        ------------------------------------------------------------
XM_005249481.1      GAGGCCATTCTAGGATCGGAGGGGTCAGTGTCCTGCCTCTACCCCCACCCCATACCTTGT
NM_005452.5         ------------------------------------------------------------
XM_005275491.1      GAGGCCATTCTAGGATCGGAGGGGTCAGTGTCCTGCCTCTACCCCCACCCCATACCTTGT
XM_005275064.1      GAGGCCATTCTAGGATCGGAGGGGTCAGTGTCCTGCCTCTACCCCCACCCCATACCTTGT
XM_005275320.1      GAGGCCATTCTAGGATCGGAGGGGTCAGTGTCCTGCCTCTACCCCCACCCCATACCTTGT
XM_005272908.1      GAGGCCATTCTAGGATCGGAGGGGTCAGTGTCCTGCCTCTACCCCCACCCCATACCTTGT
                                                                                

HsCD00083699        ------------------------------
XM_005249481.1      GGCTGCTGTGGCCTTAGCTTTGCCTTTTAG
NM_005452.5         ------------------------------
XM_005275491.1      GGCTGCTGTGGCCTTAGCTTTGCCTTTTAG
XM_005275064.1      GGCTGCTGTGGCCTTAGCTTTGCCTTTTAG
XM_005275320.1      GGCTGCTGTGGCCTTAGCTTTGCCTTTTAG
XM_005272908.1      GGCTGCTGTGGCCTTAGCTTTGCCTTTTAG
                                                  

Protein

SMART domain : WD40 : WD40 repeats
SMART domain : BING4CT : BING4CT (NUC141) domain
Structural Annotation Wiki : TOPSAN
UniProt : O15213
UniProt : B4DP15
UniProt : A8K806
HPRD : 12839

Clone

Cloning Information : 268827
HIP Master Clone ID : 200402
Original Clone ID : 1025.1.55_GO.34949

Experimental

TargetTrack - Experimental data : GO.34949

Organism


TAX_ID : 9606
Species Specific ID: 9277

Genome

Chromosome : 6
Map Location : 6p21.3
Ensembl : ENSG00000227057

Reagents

Labome : WDR46-antibody