DNASU Plasmid Repository • 480.965.5697 | Email

TM0070 (Thermotoga maritima) in pMH2T7 (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TM0070
Gene Name:  endo-1,4-beta-xylanase B
Sequence             
Original Clone ID: 7031
Keyword: None
Species: Thermotoga maritima
Type: cDNA
Vector Name: pMH2T7               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: Next amino acid codon after CDS represents STOP, hence clone should be labeled for CDS 'fusion', overall 'closed'
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Joint Center for Structural Genomics
TmCD00083955

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1044nts         Open reading frame : 37 to 1080

ATGGGATCTGATAAAATTCATCATCATCATCATCACATGAAAATATTACCTTCTGTGTTG
ATCCTTTTGTTGGGATGTGTTCCAGTTTTCAGCTCTCAGAATGTATCTCTGAGAGAACTC
GCAGAAAAGCTGAACATCTATATTGGTTTTGCCGCAATCAACAACTTTTGGTCTCTTTCC
GACGCAGAAAAGTACATGGAAGTTGCAAGAAGAGAATTCAACATCCTGACCCCTGAGAAC
CAGATGAAGTGGGATACGATTCATCCAGAAAGAGACAGATACAATTTCACTCCCGCTGAA
AAACACGTTGAGTTTGCAGAAGAAAACGACATGATCGTGCATGGACACACTCTTGTCTGG
CACAACCAGCTTCCTGGATGGATCACTGGTAGAGAATGGACAAAGGAAGAACTTTTGAAC
GTTCTTGAAGACCACATAAAAACGGTGGTGTCTCATTTCAAAGGTAGAGTGAAGATCTGG
GATGTGGTGAACGAAGCGGTGAGCGATTCTGGAACCTACAGGGAAAGCGTGTGGTACAAG
ACGATCGGTCCTGAATACATTGAAAAAGCGTTCAGATGGGCAAAAGAAGCCGATCCAGAT
GCGATTCTCATCTACAACGACTACAGCATAGAAGAAATCAACGCAAAATCGAACTTCGTC
TACAACATGATAAAAGAGCTGAAAGAAAAGGGAGTACCTGTTGATGGAATAGGATTTCAG
ATGCACATAGACTACAGAGGGCTCAATTATGACAGTTTCAGAAGGAATTTGGAGAGATTT
GCGAAACTCGGTCTTCAAATATACATCACAGAGATGGATGTGAGAATTCCTCTCAGTGGT
TCGGAGGAGTATTATTTGAAAAAACAGGCTGAAGTTTGTGCGAAGATCTTCGATATATGC
TTGGACAACCCTGCAGTTAAAGCGATCCAGTTTTGGGGATTCACAGACAAATACTCCTGG
GTTCCCGGCTTTTTCAAAGGGTACGGGAAAGCGTTGCTCTTCGATGAGAATTACAACCCC
AAGCCTTGTTATTACGCGATAAAAGAGGTGCTGGAGAAAAAGATAGAAGAAAGAAAATAA
GTTTAAACGGTCTCCAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1044
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCAC

3' Linker Sequence:
GTTTAAACGGTCTCCAG

 

 Recommended Growth Condition:

Distributed in bacterial strain : DL41
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: DL41
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMH2T7

pMH2T7 in advanced viewed

Synonyms: pMH-2-T7
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial (E. coli) expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHH tag; amp resistance; restriction enzyme (Pml I/Pac I) or PIPE cloning.
Comments: None
Size (bp): 4084
Parent Vector: None
Empty Vector: None
Properties: PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColEI origin of replication 1921 2603
promoter T7 T7 promoter 290 310
promoter araC araC promoter 256 285
selectable marker AmpR ampicillin resistance gene 1164 1823
tag His N-terminal 6x His tag 367 381
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism

Gene

 

Gene Symbol : TM0070
GENEID : 896895
Locus Tag : TM0070
Target GenBank: NP_227886

 

Protein

SMART domain : Glyco_10 : Glycosyl hydrolase family 10
Structural Annotation Wiki : TOPSAN

Clone

Cloning Information : 271588
HIP Master Clone ID : 202298
Original Clone ID : 7031

Experimental

TargetTrack - Experimental data : 281951

Organism


TAX_ID : 243274
Species Specific ID: 896895