DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pEU-His-FV

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pEU-His-FV              
Source: CESG
Description: Cell-free expression vector, adds N-terminal 6xHis tag; amp resistance; restriction enzyme cloning (SgfI, PmeI); Cloning into this vector will remove the BarCat casstte.
Comments: None
Publications: PMID: 15782178
Title: Cell-free protein production and labeling protocol for NMR-based structural proteomics
PMID: 23662776
Title: Structural and functional characterization of CalS11, the TDPrhamnose 3-O-methyltransferase involved in calicheamicin biosynthesis
PMID: 23662776
Title: Structural and functional characterization of CalS11, the TDPrhamnose 3-O-methyltransferase involved in calicheamicin biosynthesis
PMID: 18765284
Title: Wheat germ cell-free translation, purification, and assembly of a functional human stearoyl-CoA desaturase complex.
PMID: 19892197
Title: Cell-free translation of integral membrane proteins into unilamelar liposomes.
PMID: 20637905
Title: Robotic large-scale application of wheat cell-free translation to structural studies including membrane proteins.
PMID: 21899277
Title: Amino acid determinants of substrate selectivity in the Trypanosoma brucei sphingolipid synthase family.
PMID: 25854603
Title: "Expression platforms for producing eukaryotic proteins: a comparison of E. coli cell-based and wheat germ cell-free synthesis, affinity and solubility tags, and cloning strategies"
Authors: PSI
Center for Eukaryotic Structural Genomics
University of Wisconsin
EvNO00084283

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI,Promega

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : BR610
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pEU-His-FV

pEU-His-FV in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pEU319 Forward
Reverse:  pEU Reverse
Description: Cell-free expression vector, adds N-terminal 6xHis tag; amp resistance; restriction enzyme cloning (SgfI, PmeI).
Comments: Cloning into this vector will remove the BarCat casstte. To avoid, the toxicity of the barnase gene, the vector pEU-HSBC (EvNO00306667) can be ordered, which substitutes sacB for barnase.
Size (bp): 4966
Parent Vector: None
Properties: cell-free expression, multiple cloning site, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 15782178
Title: Cell-free protein production and labeling protocol for NMR-based structural proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 2809 3491
gene fragment TMV-L TMV-L 278 2238
gene fragment Omega TMV Omega 397 520
gene fragment BarCat-cat BarCat cassette, including CAT 1010 1667
gene fragment BarCat-bar BarCat cassette, including Barnase 572 908
primer His2 forward His2 forward sequencing primer TCTTTCAAATACTTCTAGCTAGAGTA 424 449
promoter SP6 SP6 promoter 373 390
recombination site MCS pF1K (Flexi-Vector) homology domain 1675 1803
selectable marker AmpR ampicillin resistance gene 3589 4248
tag His 6xHis tag 527 544

 

Species Specific ID: None
Target GenBank: None