DNASU Plasmid Repository • 480.965.2857 | Email

TEVgp1 (Tobacco etch virus) in pMHTDelta238 (vector expressing the TEV protease)

TOP

Explanation of Terms


Gene: Gene Symbol:  TEVgp1
Gene Name:  Tobacco Etch Virus (TEV) Protease
Sequence              Map: MHT_Map.pdf
Original Clone ID: None
Keyword: None
Species: Tobacco etch virus
Type: cDNA
Vector Name: pMHTDelta238               Format:  CLOSED
Source: CESG
Description: E. coli expression vector; expresses mutated form of MBP-T7 tagged TEV protease; MBP portion of the fusion is removed in vivo by autocleavage; kanamycin resistance
Comments: expresses MBP-His tagged TEV protease
Mutation/
Discrepancy :
Unknown / Unknown
Publications: PMID: 17543538
Title: A combined approach to improving large-scale production of tobacco etch virus protease.
PMID: 23566202
Title: The intrinsically disordered membrane protein selenoprotein s is a reductase in vitro
PMID: 23566202
Title: The intrinsically disordered membrane protein selenoprotein s is a reductase in vitro
PMID: 23159557
Title: Se enrichment of proteins expands the biological NMR toolbox
PMID: 22963794
Title: Expression and purification of the membrane enzyme selenoprotein K
PMID: 20064616
Title: Properties of a homogeneous C-lobe prepared by introduction of a TEV cleavage site between the lobes of human transferrin
PMID: 24509858
Title: Stereochemical features of glutathione-dependent enzymes in the Sphingobium sp. strain SYK-6 beta-aryl etherase pathway
Authors: PSI
Center for Eukaryotic Structural Genomics
University of Wisconsin
TvCD00084286

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 714nts         Open reading frame : 81 to 713

GTGCCGGGCTGGAAGTTCTGTTCCAGGGGCCCGAAAACCTGTACTTCCAGGCGATCGCCC
ATCATCATCATCATCATCATGGAGAAAGCTTGTTTAAGGGGCCGCGTGATTACAACCCGA
TATCGAGCTCCATTTGTCATTTGACGAATGAATCTGATGGGCACACAACATCGTTGTATG
GTATTGGATTTGGTCCCTTCATCATTACAAACAAGCACTTGTTTAGAAGAAATAATGGAA
CACTGTTGGTCCAATCACTACATGGTGTATTCAAGGTCAAGGACACCACGACTTTGCAAC
AACACCTCGTTGATGGGAGGGACATGATAATTATTCGCATGCCTAAGGATTTCCCACCAT
TTCCTCAAAAGCTGAAATTTAGAGAGCCACAAAGGGAAGAGCGCATATGTCTTGTGACAA
CCAACTTCCAAACTAAGAGCATGTCTAGCATGGTGTCAGACACTAGTTGCACATTCCCTT
CATCTGATGGCATATTCTGGAAGCATTGGATTCAAACCAAGGATGGGCAGTGTGGCAGTC
CATTAGTATCAACTAGAGATGGGTTCATTGTTGGTATACACTCAGCATCGAATTTCACCA
ACACAAACAATTATTTCACAAGCGTGCCGAAAAACTTCATGGAATTGTTGACAAATCAGG
AGGCGCAGCAGTGGGTTAGTGGTTGGCGATTAAATGCTGACTCAGTATTGTGGG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: 
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMHTDelta238

pMHTDelta238 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pMHTDelta238-F
Reverse:  pMHTDelta238-R
Description: E. coli expression vector; expresses a mutated and truncated form of TEV protease as an N-terminal fusion to MBP-His7; The MBP portion of the fusion is removed in vivo by autocleavage leaving His7-TEV; kanamycin resistance
Comments: MBP portion of the TEV fusion is removed in vivo by autocleavage leaving a His tagged TEV
Size (bp): 5777
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
University of Wisconsin
Publications: PMID: 17543538
Title: A combined approach to improving large-scale production of tobacco etch virus protease.

Vector Map:         Vector Sequence:
Sequence: Not Available

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR332 bacterial origin 3573 4802
promoter T5 T5 phage promoter 120 202
promoter NPTII NPTII promoter for kanR gene 0 0
promoter LacIq promoter for LacI 2495 3563
protease cleavage site 3C 3C protease cleavage site 1358 1382
protease cleavage site TEV TEV protease cleavage site 1383 1402
repressor protein gene LacI Lac inhibitor 2403 2494
selectable marker KanR kanamycin resistance gene 4808 5603
tag MBP Maltose Binding Protein (MBP) tag 230 1338
tag His 7xHis tag 1409 1430
trxn termination sequence rrnB T1 terminator rrnB 2218 2316

 


Labome: TEVgp1-antibody
Other Link: SBKB Technology Portal
Other Link: SBKB Technology Portal
Species Specific ID: 1502321
Target GenBank: None