DNASU Plasmid Repository • 480.965.5697 | Email

BID (Homo sapiens) in pJFT7_nHalo_DC(r4)

TOP

Explanation of Terms


Gene: Gene Symbol:  BID
Gene Name:  BH3 interacting domain death agonist
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJFT7_nHalo_DC(r4)               Format:  CLOSED
Source: Center for Personalized Diagnostics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00843712

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 726nts        
Open reading frame : 329 to 1054

AGAAAAAACCCGCGGGCCTGGCCGGGTGCAGGCCACCCTTGCCGGCGGATAGGAATCCCC
GCCCACACCGTGGTCTTTCCAGCACCGCAGACACCTGCCGGCTCCTCCCGAGCGGAGCTC
AGGGCTGACAAAGCGCGGTCAGAGCGGCCGCTTACTGGGGCTCGCCCGCTCCTTAGAGCA
CTGGCAATGATGTGCGGATCCTCGCTGCTGCTGCTGGGAAACTGTTGAGTGGCTGAATGA
CCCCAGGGGACCCTGGGAGAGCTCTGAAGCCCTCAGCCACCAAGTGGCTGGGCTGGCAAG
GGTTCATTCATTCATTCAACAAATACGAATGTGCAGCGGTGCTGGGGTCATGATGGCTCG
GTGGGCAGCGAGGGGCCGGGCCGGCTGGAGGAGCACAGTGCGGATTCTGTCGCCACTGGG
ACACTGTGAACCAGGAGTGAGTCGGAGCTGCCGCGCTGCCCAGGCCATGGACTGTGAGGT
CAACAACGGTTCCAGCCTCAGGGATGAGTGCATCACAAACCTACTGGTGTTTGGCTTCCT
CCAAAGCTGTTCTGACAACAGCTTCCGCAGAGAGCTGGACGCACTGGGCCACGAGCTGCC
AGTGCTGGCTCCCCAGTGGGAGGGCTACGATGAGCTGCAGACTGATGGCAACCGCAGCAG
CCACTCCCGCTTGGGAAGAATAGAGGCAGATTCTGAAAGTCAAGAAGACATCATCCGGAA
TATTGCCAGGCACCTCGCCCAGGTCGGGGACAGCATGGACCGTAGCATCCCTCCGGGCCT
GGTGAACGGCCTGGCCCTGCAGCTCAGGAACACCAGCCGGTCGGAGGAGGACCGGAACAG
GGACCTGGCCACTGCCCTGGAGCAGCTGCTGCAGGCCTACCCTAGAGACATGGAGAAGGA
GAAGACCATGCTGGTGCTGGCCCTGCTGCTGGCCAAGAAGGTGGCCAGTCAAACGCCGTC
CTTGCTCCGTGATGTCTTTCACACAACAGTGAACTTTATTAACCAGAACCTACGCACCTA
CGTGAGGAGCTTAGCCAGAAATGGGATGGACTGAACGGACAGTTCCAGAAGTGTGACTGG
CTAAAGCTCGATGTGGTCACAGCTGTATAGCTGCTTCCAGTGTAGACGGAGCCCTGGCAT
GTCAACAGCGTTCCTAGAGAAGACAGGCTGGAAGATAGCTGTGACTTCTATTTTAAAGAC
AATGTTAAACTTATAACCCACTTTAAAATATCTACATTAATATACTTGAATGAAAATGTC
CATTTACACGTATTTGAATGGCCTTCATATCATCCACACATGAATCTGCACATCTGTAAA
TCTACACACGGTGCCTTTATTTCCACTGTGCAGGTTCCCACTTAAAAATTAAATTGGAAA
GCAGGTTTCAAGGAAGTAGAAACAAAATACAATTTTTTTGGTAAAAAAAAATTACTGTTT
ATTAAAGTACAACCATAGAGGATGGTCTTACAGCAGGCAGTATCCTGTTTGAGGAAAGCA
AGAATCAGAGAAGGAACATACCCCTTACAAATGAAAAATTCCACTCAAAATAGGGACTAT
CTATCTATCTTAATACTAAGGAACCAACAATCTTCCTGTTTAAAAAACCACATGGCACAG
AGATTCTGAACTAAAGTGCTGCACTCAAATGATGGGAAGTCCGGCCCCAGTACACAGGGG
CTTGACTTTTTCAACTTCGTTTCCTTTGTTGGAGTCAAAAAGAACCACTTGTGGTTCTAA
AAGGTGTGAAGGTGATTTAAGGGCCCAGGTCAGCCACTGTTTGTTTACAAAATCAGGTAA
CTAACTGCATACACTTTTTCTCTTTCCATGACATCAAGACTTTGCTAAAGACATGAAGCC
ACGGGTGCCAGAAGCTACTGCGATGCCCCGGGAGTTAGCCCCCTGGTAATAGCTGTAAAC
TTCCAATTTCTAGCCATACGCTCAGCTCATCCATGCCTCAGAAGTGCATCTGGAGAGAAC
AGGTTTCTAAGCATAAAAGATGAAAGAGCAGTTGGACTTTTTAAAAATTCAGCAAAGTGG
TTCCCTCTCTTAGGGACAGTCAAAACCAAGTCACTTAGGTAGTACCAAAATAAATAAGGA
AAAGCTTAGCTTTAGAAACAGTGCAACACTGGTCTGCTGTTCCAGTGGTAAGCTATGTCC
CAGGAATCAGTTTAAAAGCACGACAGTGGATGCTGGGTCCATATCACACACATTGCTGTG
AACAGGAAACTCCTGTGACCACAACATGAGGCCACTGGAGACGCATATGAGTAAGGGCAC
TGACGGACTCATGATTTCTTCTTACCAGATGCTTTCCTGTTCTTTGAGTTTAAAATCATC
AGAAAGGAAAAACAAACTCTATATTGTTCAGCATGCAATACATACCACGCTAGGGCTGGC
TCAATTGAAAGTGGGCAAAAGCTTACAAATACTAAAAAGAAGTGCTGCCGCGCAGTGTGG
AGGCCACTGTTTGGAAATAAATCTTCCTAACACTACAAAAAAAAAAAAAAAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJFT7_nHalo_DC(r4)

pJFT7_nHalo_DCr4 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  HaloseqF
Reverse:  pant1627r
Description: In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: One in a series of pJFT7 vectors made by J. Saul for IVTT protein expression at CPD. This vector has been modified to improve sequencing the insert with a reverse primer.
Size (bp): 6140
Parent Vector: None
Empty Vector: EvNO00623723
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Arizona State University
Joshua LaBaer
Ji Qiu
Justin Saul
Fernanda Festa
Andrea Throop
Center for Personalized Diagnostics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3425 4107
death cassette ccdB ccdB death cassette (removed in plasmids containing a gene insert) 2785 2994
enhancer CITE CITE enhancer 17 515
protease cleavage site TEV TEV protease cleavage site 1422 1442
recombination site attR1 attR1 recombination site 1458 1474
recombination site attR2 recombination site 3145 3160
selectable marker AmpR ampicillin resistance 4205 4864
selectable marker CmR chloramphenicol resistance (removed in clones containing a gene insert) 1691 2347
ssDNA origin f1 f1 origin 5633 5939
tag HALO N-terminal HALO tag 522 1409

 

  • Gene
  • Clone
  • Organism

Gene

Target GenBank: BC036364.1

 

Clone

Cloning Information : 946383

Organism


Species Specific ID: 637