DNASU Plasmid Repository • 480.965.5697 | Email

THTPA (Homo sapiens) in pVP16 (His and MBP-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  THTPA
Gene Name:  thiamine triphosphatase
Sequence             
Original Clone ID: 1100.1.49_GO.35344
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pVP16               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: His8-MBP fusion prtotein with TEV protease cleavage site is produced; after cleavage the protein obtained will be the translated CDS with the addition of SER at the N-term
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Center for Eukaryotic Structural Genomics
HsCD00084571

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 714nts         Open reading frame : 28 to 741

ACAAGTTTGTACAAAAAAGCAGGCTCCGAAAACCTGTACTTCCAGTCCGCCCAGGGCTTG
ATTGAGGTGGAGCGAAAGTTCCTTCCAGGGCCTGGCACAGAGGAGCGGCTGCAGGAGTTG
GGGGGCACCCTGGAGTACCGGGTCACCTTCCGAGACACCTACTATGACACCCCTGAGCTG
AGCCTCATGCAGGCTGACCACTGGCTGCGACGACGAGAGGATAGTGGATGGGAGCTCAAA
TGTCCTGGAGCAGCAGGTGTCTTAGGACCCCACACGGAGTATAAGGAACTCACAGCGGAA
CCTACAATTGTGGCCCAACTCTGTAAGGTGCTGCGGGCTGACGGCCTGGGGGCTGGAGAT
GTGGCTGCTGTGCTGGGCCCACTGGGGCTGCAGGAAGTAGCTAGTTTTGTGACTAAGCGG
AGTGCCTGGAAGCTGGTGCTCTTGGGAGCTGATGAAGAGGAGCCACAGCTCAGGGTGGAC
TTGGATACAGCCGACTTTGGCTACGCTGTGGGTGAGGTAGAGGCCCTGGTGCATGAGGAG
GCTGAAGTACCAACTGCCCTAGAGAAGATCCACAGGCTCAGCAGCATGCTTGGTGTGCCT
GCACAGGAGACAGCACCAGCCAAGCTGATTGTGTATCTACAGCGTTTCCGGCCTCAAGAC
TATCAGCGCCTGCTAGAAGTGAACAGCTCCAGAGAGAGGCCACAGGAGACTGAAGATCCT
GACCACTGCCTGGGCTAGTAGGACCCAGCTTTCTTGTACAAAGTGGT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 1
End on reference sequence 714
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ACAAGTTTGTACAAAAAAGCAGGCTCC

3' Linker Sequence:
GACCCAGCTTTCTTGTACAAAGTGGT

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
SolubleProtein: Protein_Soluble
ProteinPurified: Protein_Purified
Find experimental protocols in GO.35344
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pVP16

pVP16 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  MBP Forward
Reverse:  pQE Reverse
Description: Bacterial (E. coli) expression, adds N-terminal 8xHis and MBP, adds TEV site on 5p end of insert; ampicillin resistance in bacteria; recombinational cloning; Gateway cloning into this vector will remove the Gateway ccdB death casette.
Comments: TEV protease cleavage site is "partial" and not functional. The TEV cleavage site must be added to the insert by PCR, which allows amino acids encoded by the attB1 site to be cut off after protein expression. Gateway cloning into this vector will remove the Gateway cassette
Size (bp): 7631
Parent Vector: None
Empty Vector: EvNO00084279
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 15750721
Title: Results from high-throughput DNA cloning of Arabidopsis thaliana target genes using site-specific recombination

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 6471 5789
negative selection marker ccdB ccdB death cassette gene (lost in with-insert form) 2643 2852
promoter T5 T5 promoter 5 54
recombination site AttR1 AttR1 recombination site 1316 1440
recombination site AttR2 AttR2 recombination site 3020 2896
repressor protein gene LacI LacI coding region 4132 5211
selectable marker AmpR ampicillin resistance gene 7228 6569
selectable marker CmR chloramphenicol resistance gene (CmR) (Lost in with-insert form) 1549 2205
tag His N-terminal 8xHis tag 128 145
tag MBP N-terminal MBP 148 1246

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : THTPA
Symbol Nomenclature : THTPA
SYNONYM : RP11-66N24.4; THTP; THTPASE
Designation : thiamine-triphosphatase
Full Nomenclature : thiamine triphosphatase
GENEID : 79178
HGNC : 18987
MIM : 611612
Vega : OTTHUMG00000172558
Target GenBank: BC002984

 

Pathways

Panther : Thiamin metabolism
Reactome : Defective AMN causes hereditary megaloblastic anemia 1
Reactome : Defective BTD causes biotidinase deficiency
Reactome : Defective CD320 causes methylmalonic aciduria
Reactome : Defective CUBN causes hereditary megaloblastic anemia 1
Reactome : Defective GIF causes intrinsic factor deficiency
Reactome : Defective HLCS causes multiple carboxylase deficiency
Reactome : Defective LMBRD1 causes methylmalonic aciduria and homocystinuria type cblF
Reactome : Defective MMAA causes methylmalonic aciduria type cblA
Reactome : Defective MMAB causes methylmalonic aciduria type cblB
Reactome : Defective MMACHC causes methylmalonic aciduria and homocystinuria type cblC
Reactome : Defective MMADHC causes methylmalonic aciduria and homocystinuria type cblD
Reactome : Defective MTR causes methylmalonic aciduria and homocystinuria type cblG
Reactome : Defective MTRR causes methylmalonic aciduria and homocystinuria type cblE
Reactome : Defective MUT causes methylmalonic aciduria mut type
Reactome : Defective TCN2 causes hereditary megaloblastic anemia
Reactome : Defects in biotin (Btn) metabolism
Reactome : Defects in cobalamin (B12) metabolism
Reactome : Defects in vitamin and cofactor metabolism
Reactome : Disease
Reactome : Metabolism
Reactome : Metabolism of vitamins and cofactors
Reactome : Metabolism of water-soluble vitamins and cofactors
Reactome : Vitamin B1 (thiamin) metabolism

Protein

SMART domain : CYTH :
Structural Annotation Wiki : TOPSAN
UniProt : Q9BU02
HPRD : 15505

Clone

Cloning Information : 275153
HIP Master Clone ID : 204774
Original Clone ID : 1100.1.49_GO.35344

Experimental

TargetTrack - Experimental data : GO.35344

Organism


TAX_ID : 9606
Species Specific ID: 79178

Genome

Chromosome : 14
Map Location : 14q11.2
Ensembl : ENSG00000259431