DNASU Plasmid Repository • 480.965.5697 | Email

TM0710 (Thermotoga maritima) in pMH1 (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TM0710
Gene Name:  MarR family transcriptional regulator
Sequence             
Original Clone ID: 7390
Keyword: None
Species: Thermotoga maritima
Type: cDNA
Vector Name: pMH1               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Joint Center for Structural Genomics
TmCD00085026

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 432nts         Open reading frame : 51 to 482

AGATATACATACCCATGGGATCTGATAAAATTCATCATCATCATCATCACGTGAAGCAAC
CTTTTGAAAGAATTCTCAGAGAGATCTGTTTCATGGTGAAGGTGGAAGGCAGAAAGGTGT
TGAGAGACTTCGGCATAACACCGGCTCAGTTCGACATTCTTCAGAAGATCTATTTCGAAG
GTCCCAAACGTCCAGGAGAACTCAGTGTTCTGCTGGGAGTTGCGAAGAGCACGGTGACCG
GTCTGGTGAAAAGACTCGAGGCGGACGGTTATCTGACGCGCACTCCAGACCCCGCGGACC
GGAGAGCCTACTTTCTGGTTATAACGAGAAAAGGAGAGGAGGTCATAGAAAAGGTCATCG
AACGAAGGGAGAATTTCATCGAGAAGATCACAAGCGATCTTGGTAAAGAAAAATCCTCAA
AGATACTCGACTATCTGAAGGAGTTGAAGGGCGTTATGGAGAGAAATTTTTCCAAACAAT
AAGTTTAAACGGTCTCCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 1
End on reference sequence 432
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCAC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DL41
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: SolubleProtein: Tested_Not_Soluble
ProteinExpressed: Not_Applicable
ProteinPurified: Protein_Purified
Find experimental protocols in 282580
Recommended expression in: DL41
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMH1

pMH1 in advanced viewed

Synonyms: pMH-1
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial (E. coli) expression vector, arabinose inducible expression, adds N-terminal 6xHis tag; amp resistance; restriction enzyme (Pml I/Psi I) or PIPE cloning.
Comments: None
Size (bp): 4048
Parent Vector: None
Empty Vector: None
Properties: PIPE cloning, bacterial expression, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 1887 2569
inducible trxn activator protein gene araC araC cds 3144 4019
promoter araC araC promoter 256 285
promoter pBAD pBAD promoter 250 277
selectable marker AmpR ampicillin resistance gene 1130 1789
tag His N-terminal 6xHis tag 364 381
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn termination sequence rrnB rrnB T2 transcription terminator 794 820

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism

Gene

 

Gene Symbol : TM0710
GENEID : 898377
Locus Tag : TM0710
Target GenBank: NP_228519

 

Clone

Cloning Information : 276011
HIP Master Clone ID : 205497
Original Clone ID : 7390

Experimental

TargetTrack - Experimental data : 282580

Organism


TAX_ID : 243274
Species Specific ID: 898377