DNASU Plasmid Repository • 480.965.5697 | Email

TM0754 (Thermotoga maritima) in pMH1 (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TM0754
Gene Name:  oxidoreductase
Sequence             
Original Clone ID: 7421
Keyword: None
Species: Thermotoga maritima
Type: cDNA
Vector Name: pMH1               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 19084524
Title: Reductive dioxygen scavenging by flavo-diiron proteins of Clostridium acetobutylicum
Authors: PSI
Joint Center for Structural Genomics
TmCD00085043

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1077nts         Open reading frame : 51 to 1127

AGATATACATACCCATGGGATCTGATAAAATTCATCATCATCATCATCACGTGAAAGTAG
TGATCGTTGGAAACGGCCCCGGCGGGGTTGAACTCGCAAAACAGCTTTCAGAAGAACACG
AGGTCACCATCGTGGAAAGAGAAACGGTGCCCTACTACACGAAACCCATGCTCAGCCATT
ACGTCGCGGGACTGGCGGAAGAAAAAAGTCTCTTTCCCTATCCGATCGACTGGTACGAAA
AGAAGGGAATAAAACTCCTTCTTGGAACAACCGCAAAGAGAATAGACGCAGAAAAGAAAG
TTCTCGAAACAGACAGAGGAACCCTTGAATATGACGTCCTCGTTCTCGCAACGGGTGCAA
AGCCAAGGACACTGAAGATACCCGGCTGGGAGCGAATGTACACTCTGAGGACGATAGAAG
ATGCAAAAAGATTGAAAGGAGCAGTAGAAAGAGAGAAAGATCTTCTCATCATCGGCGGAG
GGTTCATCGGTCTTGAAATCGCAGGAAATCTGTCGAAGCAGGGTATCAAAGTGAAAGTGG
TTGAGAAAATGACCCGTCTCATGGGGCTGGACGAAGAACTGACAGAGAGAATAAAAGGAG
AGCTCGAAAAACACGGAGTGGAGTTTTACCTCGGCAGGGACGTGGAGAGAATAGAAAACG
ATGTTCTCGTCACAGACAAAGAAGAGATACCGGCGAGGGTGATTCTCTGCTCCATAGGAA
TTGTCCCGGAGGTGTCGCTCGCAAAGGAGAGCGGACTCGATGTGAACAGAGGCATCTTGG
TGGACAAAACGTTCAGAACCTCGAAACCTGACATATATGCCATTGGAGACTGCGCAGAGC
ACGAAGGCATCATCTGTGGAACGGCGAAAGCCGCTATGGCACACGCGAAAGTTCTGGCAA
ACACGTTGAAGGGCATACCCGATGAGTACGATTTCCACTTCAGATCTTCTTACTTCAAGT
TCGGAGACTTTCCTATAGCCATAGTTGGAGAGCTCACAGACAGAGGAGAGTGGATCGACA
GCGAAACAAAGTCTTTCTACAGAGACGAAAAAATCGTCGGTGTGGTCGTTCTCTCCGACG
TGAGAAAAGCCAGGGAGTGGGAGGAAAGACTAAGAAGCACGCGATAAGTTTAAACGGTCT
CCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 1
End on reference sequence 1077
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCAC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DL41
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: SolubleProtein: Protein_Soluble
ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
Find experimental protocols in 282624
Recommended expression in: DL41
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMH1

pMH1 in advanced viewed

Synonyms: pMH-1
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial (E. coli) expression vector, arabinose inducible expression, adds N-terminal 6xHis tag; amp resistance; restriction enzyme (Pml I/Psi I) or PIPE cloning.
Comments: None
Size (bp): 4048
Parent Vector: None
Empty Vector: None
Properties: PIPE cloning, bacterial expression, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 1887 2569
inducible trxn activator protein gene araC araC cds 3144 4019
promoter araC araC promoter 256 285
promoter pBAD pBAD promoter 250 277
selectable marker AmpR ampicillin resistance gene 1130 1789
tag His N-terminal 6xHis tag 364 381
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn termination sequence rrnB rrnB T2 transcription terminator 794 820

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism

Gene

 

Gene Symbol : TM0754
GENEID : 898422
Locus Tag : TM0754
Target GenBank: NP_228563

 

Protein

Structural Annotation Wiki : TOPSAN
Swissprot ID : Q9WZL3

Clone

Cloning Information : 275974
HIP Master Clone ID : 205460
Original Clone ID : 7421

Experimental

TargetTrack - Experimental data : 282624

Organism


TAX_ID : 243274
Species Specific ID: 898422