DNASU Plasmid Repository • 480.965.5697 | Email

PSMB8 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PSMB8
Gene Name:  proteasome (prosome, macropain) subunit, beta type, 8
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131080.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000857

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 819nts         Open reading frame : 1 to 819
Reference Sequence Alignment

ATGCTCATAGGAACCCCCACCCCGCGTGACACTACTCCCAGCTCCTGGCTGACTTCTAGT
CTTCTGGTTGAAGCTGCGCCTTTAGATGACACGACCCTACCCACCCCTGTTTCCAGCGGA
TGCCCGGGCCTGGAGCCCACAGAATTCTTCCAGTCCCTGGGTGGGGACGGAGAAAGGAAC
GTTCAGATTGAGATGGCCCATGGCACCACCACGCTCGCCTTCAAGTTCCAGCATGGAGTG
ATTGCAGCAGTGGATTCTCGGGCCTCAGCTGGGTCCTACATTAGTGCCTTACGGGTGAAC
AAGGTGATTGAGATTAACCCTTACCTGCTTGGCACCATGTCTGGCTGTGCAGCAGACTGT
CAGTACTGGGAGCGCCTGCTGGCCAAGGAATGCAGGCTGTACTATCTGCGAAATGGAGAA
CGTATTTCAGTGTCGGCAGCCTCCAAGCTGCTGTCCAACATGATGTGCCAGTACCGGGGC
ATGGGCCTCTCTATGGGCAGTATGATCTGTGGCTGGGATAAGAAGGGTCCTGGACTCTAC
TACGTGGATGAACATGGGACTCGGCTCTCAGGAAATATGTTCTCCACGGGTAGTGGGAAC
ACTTATGCCTACGGGGTCATGGACAGTGGCTATCGGCCTAATCTTAGCCCTGAAGAGGCC
TATGACCTTGGCCGCAGGGCTATTGCTTATGCCACTCACAGAGACAGCTATTCTGGAGGC
GTTGTCAATATGTACCACATGAAGGAAGATGGTTTGGTGAAAGTAGAAAGTACAGATGTC
AGTGACCTGCTGCACCAGTACCGGGAAGCCAATCAAGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1039
Start on reference sequence 221
Mutations:
None
Discrepancy:
t615g; g755t,W252L
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PSMB8
Symbol Nomenclature : PSMB8
SYNONYM : ALDD; D6S216; D6S216E; JMP; LMP7; NKJO; PSMB5i; RING10
Designation : large multifunctional peptidase 7|low molecular mass protein 7|low molecular weight protein 7|macropain subunit C13|multicatalytic endopeptidase complex subunit C13|protease component C13|proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)|proteasome catalytic subunit 3i|proteasome component C13|proteasome subunit Y2|proteasome subunit beta 5i|proteasome subunit beta type-8|proteasome-related gene 7|really interesting new gene 10 protein
Full Nomenclature : proteasome (prosome, macropain) subunit, beta type, 8
GENEID : 5696
Locus Tag : DAAP-57C1.3
GI : 60826856
GenBank Accession : AY893737
HGNC : 9545
MIM : 177046
Vega : OTTHUMG00000031285
Target GenBank: NM_004159

 

Reference Sequence Alignment

  

HsCD00000857      ------------ATGCTCATAGGAACCCCCACCCCGCGTGACACTACTCCCAGCTCCTGG
NM_004159.4       ------------ATGCTCATAGGAACCCCCACCCCGCGTGACACTACTCCCAGCTCCTGG
NM_148919.3       ATGGCGCTACTAGATGTATGCGGAGCCCCCCGAGGGCAGCGGCCGGAATCGGCTCTCCCG
                              .:  *.: .***.*****. .  **.  . .* ..: * .    *  *

HsCD00000857      CTGACTTCTAGTCTTCTGGTTGAAGCTGCGCCTTTAGATGACACGACCCTACCCACCCCT
NM_004159.4       CTGACTTCTAGTCTTCTGGTTGAAGCTGCGCCTTTAGATGACACGACCCTACCCACCCCT
NM_148919.3       GTTGCGGGAAGCGGGCGTCGCTCGGACCCAGGACACTACAGTTTCTCTATGCGATCTCCA
                   * .*   :**    *      ..*.  *.  : :. * .. :  :* .*.* .:* **:

HsCD00000857      GTTTCCAGCGGATGCCCGGGCCTGGAGCCCACAGAATTCTTCCAGTCCCTGGGTGGGGAC
NM_004159.4       GTTTCCAGCGGATGCCCGGGCCTGGAGCCCACAGAATTCTTCCAGTCCCTGGGTGGGGAC
NM_148919.3       GAGCTCGCTTTACCCCGGGGAATGCAGCCCACAGAATTCTTCCAGTCCCTGGGTGGGGAC
                  *:   *.    *  ** ***..** ***********************************

HsCD00000857      GGAGAAAGGAACGTTCAGATTGAGATGGCCCATGGCACCACCACGCTCGCCTTCAAGTTC
NM_004159.4       GGAGAAAGGAACGTTCAGATTGAGATGGCCCATGGCACCACCACGCTCGCCTTCAAGTTC
NM_148919.3       GGAGAAAGGAACGTTCAGATTGAGATGGCCCATGGCACCACCACGCTCGCCTTCAAGTTC
                  ************************************************************

HsCD00000857      CAGCATGGAGTGATTGCAGCAGTGGATTCTCGGGCCTCAGCTGGGTCCTACATTAGTGCC
NM_004159.4       CAGCATGGAGTGATTGCAGCAGTGGATTCTCGGGCCTCAGCTGGGTCCTACATTAGTGCC
NM_148919.3       CAGCATGGAGTGATTGCAGCAGTGGATTCTCGGGCCTCAGCTGGGTCCTACATTAGTGCC
                  ************************************************************

HsCD00000857      TTACGGGTGAACAAGGTGATTGAGATTAACCCTTACCTGCTTGGCACCATGTCTGGCTGT
NM_004159.4       TTACGGGTGAACAAGGTGATTGAGATTAACCCTTACCTGCTTGGCACCATGTCTGGCTGT
NM_148919.3       TTACGGGTGAACAAGGTGATTGAGATTAACCCTTACCTGCTTGGCACCATGTCTGGCTGT
                  ************************************************************

HsCD00000857      GCAGCAGACTGTCAGTACTGGGAGCGCCTGCTGGCCAAGGAATGCAGGCTGTACTATCTG
NM_004159.4       GCAGCAGACTGTCAGTACTGGGAGCGCCTGCTGGCCAAGGAATGCAGGCTGTACTATCTG
NM_148919.3       GCAGCAGACTGTCAGTACTGGGAGCGCCTGCTGGCCAAGGAATGCAGGCTGTACTATCTG
                  ************************************************************

HsCD00000857      CGAAATGGAGAACGTATTTCAGTGTCGGCAGCCTCCAAGCTGCTGTCCAACATGATGTGC
NM_004159.4       CGAAATGGAGAACGTATTTCAGTGTCGGCAGCCTCCAAGCTGCTGTCCAACATGATGTGC
NM_148919.3       CGAAATGGAGAACGTATTTCAGTGTCGGCAGCCTCCAAGCTGCTGTCCAACATGATGTGC
                  ************************************************************

HsCD00000857      CAGTACCGGGGCATGGGCCTCTCTATGGGCAGTATGATCTGTGGCTGGGATAAGAAGGGT
NM_004159.4       CAGTACCGGGGCATGGGCCTCTCTATGGGCAGTATGATCTGTGGCTGGGATAAGAAGGGT
NM_148919.3       CAGTACCGGGGCATGGGCCTCTCTATGGGCAGTATGATCTGTGGCTGGGATAAGAAGGGT
                  ************************************************************

HsCD00000857      CCTGGACTCTACTACGTGGATGAACATGGGACTCGGCTCTCAGGAAATATGTTCTCCACG
NM_004159.4       CCTGGACTCTACTACGTGGATGAACATGGGACTCGGCTCTCAGGAAATATGTTCTCCACG
NM_148919.3       CCTGGACTCTACTACGTGGATGAACATGGGACTCGGCTCTCAGGAAATATGTTCTCCACG
                  ************************************************************

HsCD00000857      GGTAGTGGGAACACTTATGCCTACGGGGTCATGGACAGTGGCTATCGGCCTAATCTTAGC
NM_004159.4       GGTAGTGGGAACACTTATGCCTACGGGGTCATGGACAGTGGCTATCGGCCTAATCTTAGC
NM_148919.3       GGTAGTGGGAACACTTATGCCTACGGGGTCATGGACAGTGGCTATCGGCCTAATCTTAGC
                  ************************************************************

HsCD00000857      CCTGAAGAGGCCTATGACCTTGGCCGCAGGGCTATTGCTTATGCCACTCACAGAGACAGC
NM_004159.4       CCTGAAGAGGCCTATGACCTTGGCCGCAGGGCTATTGCTTATGCCACTCACAGAGACAGC
NM_148919.3       CCTGAAGAGGCCTATGACCTTGGCCGCAGGGCTATTGCTTATGCCACTCACAGAGACAGC
                  ************************************************************

HsCD00000857      TATTCTGGAGGCGTTGTCAATATGTACCACATGAAGGAAGATGGTTTGGTGAAAGTAGAA
NM_004159.4       TATTCTGGAGGCGTTGTCAATATGTACCACATGAAGGAAGATGGTTGGGTGAAAGTAGAA
NM_148919.3       TATTCTGGAGGCGTTGTCAATATGTACCACATGAAGGAAGATGGTTGGGTGAAAGTAGAA
                  ********************************************** *************

HsCD00000857      AGTACAGATGTCAGTGACCTGCTGCACCAGTACCGGGAAGCCAATCAAGAC
NM_004159.4       AGTACAGATGTCAGTGACCTGCTGCACCAGTACCGGGAAGCCAATCAATAA
NM_148919.3       AGTACAGATGTCAGTGACCTGCTGCACCAGTACCGGGAAGCCAATCAATAA
                  ************************************************ *.

Pathways

Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Securin
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : AUF1 (hnRNP D0) destabilizes mRNA
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Antigen processing-Cross presentation
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Apoptosis
Reactome : Assembly of the pre-replicative complex
Reactome : Asymmetric localization of PCP proteins
Reactome : Autodegradation of Cdh1 by Cdh1:APC/C
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : CDK-mediated phosphorylation and removal of Cdc6
Reactome : CDT1 association with the CDC6:ORC:origin complex
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cross-presentation of soluble exogenous antigens (endosomes)
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin E associated events during G1/S transition
Reactome : Cytokine Signaling in Immune system
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : Disease
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : ER-Phagosome pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : M Phase
Reactome : M/G1 Transition
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of amino acids and derivatives
Reactome : Metabolism of mRNA
Reactome : Mitotic Anaphase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Orc1 removal from chromatin
Reactome : PCP/CE pathway
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of Apoptosis
Reactome : Regulation of DNA replication
Reactome : Regulation of activated PAK-2p34 by proteasome mediated degradation
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Regulation of mitotic cell cycle
Reactome : Regulation of ornithine decarboxylase (ODC)
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : SCF-beta-TrCP mediated degradation of Emi1
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Stabilization of p53
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : TCF dependent signaling in response to WNT
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
Reactome : Vif-mediated degradation of APOBEC3G
Reactome : Vpu mediated degradation of CD4
Reactome : beta-catenin independent WNT signaling
Reactome : degradation of AXIN
Reactome : degradation of DVL
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Proteasome Degradation

Protein

UniProt : P28062
HPRD : 01515

Clone

Cloning Information : 131080
HIP Master Clone ID : 107237
Original Clone ID : FLH131080.01L

Organism


TAX_ID : 9606
Species Specific ID: 5696

Genome

Chromosome : 6
Map Location : 6p21.3
Ensembl : ENSG00000204264

Reagents

Labome : PSMB8-antibody