DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol:  None
Gene Name:  None
Sequence             
Original Clone ID: 13236
Keyword: None
Species: Thermotoga maritima
Type: cDNA
Vector Name: pMH4               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 23226342
Title: Functional characterization of two M42 aminopeptidases erroneously annotated as cellulases
Authors: PSI
Joint Center for Structural Genomics
TmCD00089984

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 996nts         Open reading frame : 51 to 1046

AGATATACATACCCATGGGATCTGATAAAATTCATCATCATCATCATCACATGAAGGAAC
TGATCAGAAAGCTGACGGAAGCCTTCGGCCCAAGTGGACGGGAAGAAGAGGTGAGAAGTA
TCATCCTCGAGGAACTCGAAGGGCACATAGATGGCCACAGGATCGATGGGCTCGGCAATC
TCATTGTCTGGAAAGGAAGCGGCGAGAAAAAGGTGATACTGGACGCTCACATAGATGAGA
TAGGTGTTGTCGTCACAAACGTGGACGACAAGGGATTTCTGACAATAGAACCCGTCGGCG
GTGTCTCTCCGTACATGCTTCTTGGAAAAAGGATCAGGTTCGAAAACGGTACAATAGGCG
TTGTTGGTATGGAAGGTGAAACAACAGAAGAAAGGCAGGAGAATGTGAGAAAGCTCTCGT
TCGACAAGCTGTTCATCGATATCGGTGCAAATTCCAGAGAAGAAGCACAGAAGATGTGCC
CAATTGGAAGCTTCGGTGTCTACGACAGTGGATTCGTCGAAGTTTCCGGGAAATACGTCT
CGAAGGCGATGGATGACAGGATAGGATGTGCCGTGATCGTGGAAGTTTTCAAAAGAATCA
AACCCGCTGTTACGCTCTACGGTGTTTTCAGTGTTCAGGAAGAAGTGGGACTGGTCGGTG
CCTCGGTGGCGGGGTACGGCGTACCAGCGGACGAGGCCATCGCGATCGATGTGACTGATT
CGGCAGACACTCCGAAGGCCATCAAGAGACACGCAATGAGGCTCTCCGGTGGACCCGCTC
TGAAAGTGAAAGACAGGGCATCGATCAGCAGCAAACGCATCCTCGAAAATTTGATAGAAA
TCGCGGAAAAATTCGATATAAAGTATCAGATGGAGGTTCTGACGTTCGGCGGTACGAACG
CCATGGGGTACCAGCGGACTAGAGAAGGGATTCCTTCGGCCACGGTGTCTATTCCCACAC
GATACGTTCACTCACCCAGTGAGATGATCGCACCAGATGATGTTGAGGCAACGGTCGATC
TTCTCATCAGGTATCTGGGGGCGTAACGCGACTTAATTAACTCTAGATAACTGAGAAGGA
GATATACATACCCGGG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1046
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCAC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in 282917
Recommended expression in: HK100
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMH4

pMH4 in advanced viewed

Synonyms: pMH-4
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHH tag; amp resistance; restriction enyzme (Pml I/Pac I) or PIPE cloning.
Comments: None
Size (bp): 5489
Parent Vector: None
Empty Vector: None
Properties: PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1 bacterial origin of replication 3331 4013
inducible trxn activator protein gene araC araC cds 5463 4585
negative selection marker ccdB ccdB negative selection gene (may be gone in with-insert form) 1576 1785
promoter T7 T7 promoter 290 310
promoter araC araC promoter 153 124
selectable marker CmR chloramphenicol resistance gene (CmR) 484 1140
selectable marker AmpR ampicillin resistance gene 2574 3233
tag His N-terminal 6xHis tag 364 381
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn termination sequence rrnB rrnB T2 transcription terminator 2238 2264

 

  • Gene
  • Protein
  • Clone
  • Experimental

Gene

Target GenBank: NP_228856.1

 

Protein

PDB - Structural Annotation : 3ISX
Structural Annotation Wiki : TOPSAN
Swissprot ID : Q9X0E0
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 454199
HIP Master Clone ID : 383685
Original Clone ID : 13236

Experimental

Structural Biology Knowledgebase : SBKB (3ISX)
TargetTrack - Experimental data : 282917