DNASU Plasmid Repository • 480.965.2857 | Email

SH3GL2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SH3GL2
Gene Name:  SH3-domain GRB2-like 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH007590.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000902

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1059nts         Open reading frame : 1 to 1059
Reference Sequence Alignment

ATGTCGGTGGCCGGCCTCAAGAAGCAGTTCCATAAAGCCACTCAGAAAGTGAGTGAGAAG
GTTGGAGGAGCTGAAGGAACCAAGCTAGATGATGACTTCAAAGAGATGGAAAGGAAAGTG
GATGTCACCAGCAGGGCTGTGATGGAAATAATGACTAAAACAATTGAATACCTTCAACCC
AATCCAGCTTCCAGAGCTAAGCTCAGCATGATCAACACCATGTCAAAAATCCGTGGCCAG
GAGAAGGGGCCAGGCTATCCTCAGGCAGAGGCGCTGCTGGCAGAGGCCATGCTCAAATTT
GGAAGAGAGCTTGGAGATGATTGCAACTTTGGCCCAGCACTTGGTGAGGTCGGGGAGGCC
ATGCGGGAACTGTCGGAGGTCAAAGACTCTTTGGACATAGAAGTGAAGCAGAACTTCATT
GACCCTCTTCAGAATCTTCATGACAAAGATCTCAGGGAAATTCAACATCATCTAAAGAAG
TTGGAGGGTCGACGCCTGGATTTTGATTATAAGAAGAAACGACAAGGCAAGATTCCGGAT
GAAGAGCTTCGTCAAGCTCTAGAGAAATTTGATGAGTCTAAGGAAATTGCTGAGTCAAGC
ATGTCCAATCTCTTGGAGATGGATATTGAACAAGTGAGCCAGCTCTCTGCACTTGTGCAA
GCTCAGCTGGAGTACCACAAGCAGGCAGTCCAGATCCTGCAGCAAGTCACGGTCAGACTG
GAAGAAAGAATAAGACAGGCTTCATCTCAGCCTAGAAGGGAATATCAACCTAAACCACGA
ATGAGCCTGGAGTTTCCAACTGGAGACAGTACTCAGCCCAATGGGGGTCTCTCCCACACA
GGCACTCCCAAACCTTCAGGTGTCCAAATGGATCAGCCCTGCTGCCGAGCTCTGTACGAC
TTTGAACCTGAAAATGAAGGGGAGTTGGGATTTAAAGAGGGCGATATCATCACACTCACT
AACCAAATTGATGAGAACTGGTATGAGGGGATGCTGCATGGCCATTCAGGCTTCTTCCCC
ATCAATTATGTGGAAATTCTGGTTGCCCTGCCCCATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1106
Start on reference sequence 48
Mutations:
None
Discrepancy:
t453c; t605c,F202S
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SH3GL2
Symbol Nomenclature : SH3GL2
SYNONYM : CNSA2; EEN-B1; SH3D2A; SH3P4
Designation : Endophilin A1 BAR domain|SH3 domain protein 2A|SH3 domain-containing GRB2-like protein 2|bA335L15.1 (SH3-domain GRB2-like 2)|endophilin-1|endophilin-A1
Full Nomenclature : SH3-domain GRB2-like 2
GENEID : 6456
GI : 61357455
GenBank Accession : AY888447
HGNC : 10831
MIM : 604465
Vega : OTTHUMG00000019601
Target GenBank: NM_003026

 

Reference Sequence Alignment

  

HsCD00000902        ATGTCGGTGGCCGGCCTCAAGAAGCAGTTCCATAAAGCCACTCAGAAAGTGAGTGAGAAG
XM_005251549.1      ------------------------------------ATGCAGAAGAAAGTGAGTGAGAAG
NM_003026.2         ATGTCGGTGGCCGGCCTCAAGAAGCAGTTCCATAAAGCCACTCAGAAAGTGAGTGAGAAG
                                                        .  .. .*****************

HsCD00000902        GTTGGAGGAGCTGAAGGAACCAAGCTAGATGATGACTTCAAAGAGATGGAAAGGAAAGTG
XM_005251549.1      GTTGGAGGAGCTGAAGGAACCAAGCTAGATGATGACTTCAAAGAGATGGAAAGGAAAGTG
NM_003026.2         GTTGGAGGAGCTGAAGGAACCAAGCTAGATGATGACTTCAAAGAGATGGAAAGGAAAGTG
                    ************************************************************

HsCD00000902        GATGTCACCAGCAGGGCTGTGATGGAAATAATGACTAAAACAATTGAATACCTTCAACCC
XM_005251549.1      GATGTCACCAGCAGGGCTGTGATGGAAATAATGACTAAAACAATTGAATACCTTCAACCC
NM_003026.2         GATGTCACCAGCAGGGCTGTGATGGAAATAATGACTAAAACAATTGAATACCTTCAACCC
                    ************************************************************

HsCD00000902        AATCCAGCTTCCAGAGCTAAGCTCAGCATGATCAACACCATGTCAAAAATCCGTGGCCAG
XM_005251549.1      AATCCAGCTTCCAGAGCTAAGCTCAGCATGATCAACACCATGTCAAAAATCCGTGGCCAG
NM_003026.2         AATCCAGCTTCCAGAGCTAAGCTCAGCATGATCAACACCATGTCAAAAATCCGTGGCCAG
                    ************************************************************

HsCD00000902        GAGAAGGGGCCAGGCTATCCTCAGGCAGAGGCGCTGCTGGCAGAGGCCATGCTCAAATTT
XM_005251549.1      GAGAAGGGGCCAGGCTATCCTCAGGCAGAGGCGCTGCTGGCAGAGGCCATGCTCAAATTT
NM_003026.2         GAGAAGGGGCCAGGCTATCCTCAGGCAGAGGCGCTGCTGGCAGAGGCCATGCTCAAATTT
                    ************************************************************

HsCD00000902        GGAAGAGAGCTTGGAGATGATTGCAACTTTGGCCCAGCACTTGGTGAGGTCGGGGAGGCC
XM_005251549.1      GGAAGAGAGCTTGGAGATGATTGCAACTTTGGCCCAGCACTTGGTGAGGTCGGGGAGGCC
NM_003026.2         GGAAGAGAGCTTGGAGATGATTGCAACTTTGGCCCAGCACTTGGTGAGGTCGGGGAGGCC
                    ************************************************************

HsCD00000902        ATGCGGGAACTGTCGGAGGTCAAAGACTCTTTGGACATAGAAGTGAAGCAGAACTTCATT
XM_005251549.1      ATGCGGGAACTGTCGGAGGTCAAAGACTCTTTGGACATAGAAGTGAAGCAGAACTTCATT
NM_003026.2         ATGCGGGAACTGTCGGAGGTCAAAGACTCTTTGGACATAGAAGTGAAGCAGAACTTCATT
                    ************************************************************

HsCD00000902        GACCCTCTTCAGAATCTTCATGACAAAGATCTCAGGGAAATTCAACATCATCTAAAGAAG
XM_005251549.1      GACCCTCTTCAGAATCTTCATGACAAAGATCTTAGGGAAATTCAACATCATCTAAAGAAG
NM_003026.2         GACCCTCTTCAGAATCTTCATGACAAAGATCTTAGGGAAATTCAACATCATCTAAAGAAG
                    ******************************** ***************************

HsCD00000902        TTGGAGGGTCGACGCCTGGATTTTGATTATAAGAAGAAACGACAAGGCAAGATTCCGGAT
XM_005251549.1      TTGGAGGGTCGACGCCTGGATTTTGATTATAAGAAGAAACGACAAGGCAAGATTCCGGAT
NM_003026.2         TTGGAGGGTCGACGCCTGGATTTTGATTATAAGAAGAAACGACAAGGCAAGATTCCGGAT
                    ************************************************************

HsCD00000902        GAAGAGCTTCGTCAAGCTCTAGAGAAATTTGATGAGTCTAAGGAAATTGCTGAGTCAAGC
XM_005251549.1      GAAGAGCTTCGTCAAGCTCTAGAGAAATTTGATGAGTCTAAGGAAATTGCTGAGTCAAGC
NM_003026.2         GAAGAGCTTCGTCAAGCTCTAGAGAAATTTGATGAGTCTAAGGAAATTGCTGAGTCAAGC
                    ************************************************************

HsCD00000902        ATGTCCAATCTCTTGGAGATGGATATTGAACAAGTGAGCCAGCTCTCTGCACTTGTGCAA
XM_005251549.1      ATGTTCAATCTCTTGGAGATGGATATTGAACAAGTGAGCCAGCTCTCTGCACTTGTGCAA
NM_003026.2         ATGTTCAATCTCTTGGAGATGGATATTGAACAAGTGAGCCAGCTCTCTGCACTTGTGCAA
                    **** *******************************************************

HsCD00000902        GCTCAGCTGGAGTACCACAAGCAGGCAGTCCAGATCCTGCAGCAAGTCACGGTCAGACTG
XM_005251549.1      GCTCAGCTGGAGTACCACAAGCAGGCAGTCCAGATCCTGCAGCAAGTCACGGTCAGACTG
NM_003026.2         GCTCAGCTGGAGTACCACAAGCAGGCAGTCCAGATCCTGCAGCAAGTCACGGTCAGACTG
                    ************************************************************

HsCD00000902        GAAGAAAGAATAAGACAGGCTTCATCTCAGCCTAGAAGGGAATATCAACCTAAACCACGA
XM_005251549.1      GAAGAAAGAATAAGACAGGCTTCATCTCAGCCTAGAAGGGAATATCAACCTAAACCACGA
NM_003026.2         GAAGAAAGAATAAGACAGGCTTCATCTCAGCCTAGAAGGGAATATCAACCTAAACCACGA
                    ************************************************************

HsCD00000902        ATGAGCCTGGAGTTTCCAACTGGAGACAGTACTCAGCCCAATGGGGGTCTCTCCCACACA
XM_005251549.1      ATGAGCCTGGAGTTTCCAACTGGAGACAGTACTCAGCCCAATGGGGGTCTCTCCCACACA
NM_003026.2         ATGAGCCTGGAGTTTCCAACTGGAGACAGTACTCAGCCCAATGGGGGTCTCTCCCACACA
                    ************************************************************

HsCD00000902        GGCACTCCCAAACCTTCAGGTGTCCAAATGGATCAGCCCTGCTGCCGAGCTCTGTACGAC
XM_005251549.1      GGCACTCCCAAACCTTCAGGTGTCCAAATGGATCAGCCCTGCTGCCGAGCTCTGTACGAC
NM_003026.2         GGCACTCCCAAACCTTCAGGTGTCCAAATGGATCAGCCCTGCTGCCGAGCTCTGTACGAC
                    ************************************************************

HsCD00000902        TTTGAACCTGAAAATGAAGGGGAGTTGGGATTTAAAGAGGGCGATATCATCACACTCACT
XM_005251549.1      TTTGAACCTGAAAATGAAGGGGAGTTGGGATTTAAAGAGGGCGATATCATCACACTCACT
NM_003026.2         TTTGAACCTGAAAATGAAGGGGAGTTGGGATTTAAAGAGGGCGATATCATCACACTCACT
                    ************************************************************

HsCD00000902        AACCAAATTGATGAGAACTGGTATGAGGGGATGCTGCATGGCCATTCAGGCTTCTTCCCC
XM_005251549.1      AACCAAATTGATGAGAACTGGTATGAGGGGATGCTGCATGGCCATTCAGGCTTCTTCCCC
NM_003026.2         AACCAAATTGATGAGAACTGGTATGAGGGGATGCTGCATGGCCATTCAGGCTTCTTCCCC
                    ************************************************************

HsCD00000902        ATCAATTATGTGGAAATTCTGGTTGCCCTGCCCCATTAG
XM_005251549.1      ATCAATTATGTGGAAATTCTGGTTGCCCTGCCCCATTAG
NM_003026.2         ATCAATTATGTGGAAATTCTGGTTGCCCTGCCCCATTAG
                    ***************************************

Pathways

NCI : Internalization of ErbB1
NCI : RhoA signaling pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : Clathrin derived vesicle budding
Reactome : Developmental Biology
Reactome : Disease
Reactome : EGFR downregulation
Reactome : Golgi Associated Vesicle Biogenesis
Reactome : Immune System
Reactome : L1CAM interactions
Reactome : Lysosome Vesicle Biogenesis
Reactome : MHC class II antigen presentation
Reactome : Membrane Trafficking
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Recycling pathway of L1
Reactome : Retrograde neurotrophin signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signalling by NGF
Reactome : trans-Golgi Network Vesicle Budding
WikiPathway : EGF/EGFR Signaling Pathway

Protein

SMART domain : BAR :
SMART domain : SH3 : Src homology 3 domains
UniProt : Q99962
UniProt : Q7Z376
UniProt : Q8IZ09
HPRD : 05125

Clone

Cloning Information : 7590
HIP Master Clone ID : 7148
Original Clone ID : FLH007590.01X

Organism


TAX_ID : 9606
Species Specific ID: 6456

Genome

Chromosome : 9
Map Location : 9p22
Ensembl : ENSG00000107295

Reagents

Labome : SH3GL2-antibody