DNASU Plasmid Repository • 480.965.5697 | Email

RPL15 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPL15
Gene Name:  ribosomal protein L15
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH007680.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000922

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 615nts         Open reading frame : 1 to 615
Reference Sequence Alignment

ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGC
TTTCTTCTGAGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCC
CGCCCCACCCGGCCTGATAAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAGGTTACGTT
ATATATAGGATTCGTGTTCGCCGTGGTGGCCGAAAACGCCCAGTTCCTAAGGGTGCAACT
TACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTAAAGTTTGCTCGAAGCCTTCAGTCC
GTTGCAGAGGAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTCCTGAATTCTTACTGG
GTTGGTGAAGATTCCACATACAAATTTTTTGAGGTTATCCTCATTGATCCATTCCATAAA
GCTATCAGAAGAAATCCTGACACCCAGTGGATCACCAAACCAGTCCACAAGCACAGGGAG
ATGCGTGGGCTGACATCTGCAGGCCGAAAGAGCCGTGGCCTTGGAAAGGGCCACAAGTTC
CACCACACTATTGGTGGCTCTCGCCGGGCAGCTTGGAGAAGGCGCAATACTCTCCAGCTC
CACCGTTACCGCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 651
Start on reference sequence 37
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPL15
Symbol Nomenclature : RPL15
SYNONYM : DBA12; EC45; L15; RPL10; RPLY10; RPYL10
Designation : 60S ribosomal protein L15
Full Nomenclature : ribosomal protein L15
GENEID : 6138
Locus Tag : TCBAP0781
GI : 61357514
GenBank Accession : AY888455
HGNC : 10306
MIM : 604174
Vega : OTTHUMG00000130485
Target GenBank: NM_002948

 

Reference Sequence Alignment

  

HsCD00000922        ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGC
NM_001253380.1      ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGC
NM_001253379.1      ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGC
NM_001253382.1      ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGC
NM_002948.3         ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGC
NM_001253383.1      ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGC
                    ************************************************************

HsCD00000922        TTTCTTCTGAGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCC
NM_001253380.1      TTTCTTCTGAGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCC
NM_001253379.1      TTTCTTCTGAGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCC
NM_001253382.1      TTTCTTCTGAGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCC
NM_002948.3         TTTCTTCTGAGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCC
NM_001253383.1      TTTCTTCTGAGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCC
                    ************************************************************

HsCD00000922        CGCCCCACCCGGCCTGATAAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAGGTTACGTT
NM_001253380.1      CGCCCCACCCGGCCTGATAAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAGGTTACGTT
NM_001253379.1      CGCCCCACCCGGCCTGATAAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAGGTTACGTT
NM_001253382.1      CGCCCCACCCGGCCTGATAAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAGGTTACGTT
NM_002948.3         CGCCCCACCCGGCCTGATAAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAGGTTACGTT
NM_001253383.1      CGCCCCACCCGGCCTGATAAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAGGTTACGTT
                    ************************************************************

HsCD00000922        ATATATAGGATTCGTGTTCGCCGTGGTGGCCGAAAACGCCCAGTTCCTAAGGGTGCAACT
NM_001253380.1      ATATATAGGATTCGTGTTCGCCGTGGTGGCCGAAAACGCCCAGTTCCTAAGGGTGCAACT
NM_001253379.1      ATATATAGGATTCGTGTTCGCCGTGGTGGCCGAAAACGCCCAGTTCCTAAGGGTGCAACT
NM_001253382.1      ATATATAGGATTCGTGTTCGCCGTGGTGGCCGAAAACGCCCAGTTCCTAAGGGTGCAACT
NM_002948.3         ATATATAGGATTCGTGTTCGCCGTGGTGGCCGAAAACGCCCAGTTCCTAAGGGTGCAACT
NM_001253383.1      ATATATAGGATTCGTGTTCGCCGTGGTGGCCGAAAACGCCCAGTTCCTAAGGGTGCAACT
                    ************************************************************

HsCD00000922        TACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTAAAGTTTGCTCGAAGCCTTCAGTCC
NM_001253380.1      TACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTAAAGTTTGCTCGAAGCCTTCAGTCC
NM_001253379.1      TACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTAAAGTTTGCTCGAAGCCTTCAGTCC
NM_001253382.1      TACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTAAAGTTTGCTCGAAGCCTTCAGTCC
NM_002948.3         TACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTAAAGTTTGCTCGAAGCCTTCAGTCC
NM_001253383.1      TACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTAAAGTTTGCTCGAAGCCTTCAGTCC
                    ************************************************************

HsCD00000922        GTTGCAGAGGAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTCCTGAATTCTTACTGG
NM_001253380.1      GTTGCAGAGGAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTCCTGAATTCTTACTGG
NM_001253379.1      GTTGCAGAGGAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTCCTGAATTCTTACTGG
NM_001253382.1      GTTGCAGAGGAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTCCTGAATTCTTACTGG
NM_002948.3         GTTGCAGAGGAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTCCTGAATTCTTACTGG
NM_001253383.1      GTTGCAGAGGAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTCCTGAATTCTTACTGG
                    ************************************************************

HsCD00000922        GTTGGTGAAGATTCCACATACAAATTTTTTGAGGTTATCCTCATTGATCCATTCCATAAA
NM_001253380.1      GTTGGTGAAGATTCCACATACAAATTTTTTGAGGTTATCCTCATTGATCCATTCCATAAA
NM_001253379.1      GTTGGTGAAGATTCCACATACAAATTTTTTGAGGTTATCCTCATTGATCCATTCCATAAA
NM_001253382.1      GTTGGTGAAGATTCCACATACAAATTTTTTGAGGTTATCCTCATTGATCCATTCCATAAA
NM_002948.3         GTTGGTGAAGATTCCACATACAAATTTTTTGAGGTTATCCTCATTGATCCATTCCATAAA
NM_001253383.1      GTTGGTGAAGATTCCACATACAAATTTTTTGAGGTTATCCTCATTGATCCATTCCATAAA
                    ************************************************************

HsCD00000922        GCTATCAGAAGAAATCCTGACACCCAGTGGATCACCAAACCAGTCCACAAGCACAGGGAG
NM_001253380.1      GCTATCAGAAGAAATCCTGACACCCAGTGGATCACCAAACCAGTCCACAAGCACAGGGAG
NM_001253379.1      GCTATCAGAAGAAATCCTGACACCCAGTGGATCACCAAACCAGTCCACAAGCACAGGGAG
NM_001253382.1      GCTATCAGAAGAAATCCTGACACCCAGTGGATCACCAAACCAGTCCACAAGCACAGGGAG
NM_002948.3         GCTATCAGAAGAAATCCTGACACCCAGTGGATCACCAAACCAGTCCACAAGCACAGGGAG
NM_001253383.1      GCTATCAGAAGAAATCCTGACACCCAGTGGATCACCAAACCAGTCCACAAGCACAGGGAG
                    ************************************************************

HsCD00000922        ATGCGTGGGCTGACATCTGCAGGCCGAAAGAGCCGTGGCCTTGGAAAGGGCCACAAGTTC
NM_001253380.1      ATGCGTGGGCTGACATCTGCAGGCCGAAAGAGCCGTGGCCTTGGAAAGGGCCACAAGTTC
NM_001253379.1      ATGCGTGGGCTGACATCTGCAGGCCGAAAGAGCCGTGGCCTTGGAAAGGGCCACAAGTTC
NM_001253382.1      ATGCGTGGGCTGACATCTGCAGGCCGAAAGAGCCGTGGCCTTGGAAAGGGCCACAAGTTC
NM_002948.3         ATGCGTGGGCTGACATCTGCAGGCCGAAAGAGCCGTGGCCTTGGAAAGGGCCACAAGTTC
NM_001253383.1      ATGCGTGGGCTGACATCTGCAGGCCGAAAGAGCCGTGGCCTTGGAAAGGGCCACAAGTTC
                    ************************************************************

HsCD00000922        CACCACACTATTGGTGGCTCTCGCCGGGCAGCTTGGAGAAGGCGCAATACTCTCCAGCTC
NM_001253380.1      CACCACACTATTGGTGGCTCTCGCCGGGCAGCTTGGAGAAGGCGCAATACTCTCCAGCTC
NM_001253379.1      CACCACACTATTGGTGGCTCTCGCCGGGCAGCTTGGAGAAGGCGCAATACTCTCCAGCTC
NM_001253382.1      CACCACACTATTGGTGGCTCTCGCCGGGCAGCTTGGAGAAGGCGCAATACTCTCCAGCTC
NM_002948.3         CACCACACTATTGGTGGCTCTCGCCGGGCAGCTTGGAGAAGGCGCAATACTCTCCAGCTC
NM_001253383.1      CACCACACTATTGGTGGCTCTCGCCGGGCAGCTTGGAGAAGGCGCAATACTCTCCAGCTC
                    ************************************************************

HsCD00000922        CACCGTTACCGCTAG
NM_001253380.1      CACCGTTACCGCTAA
NM_001253379.1      CACCGTTACCGCTAA
NM_001253382.1      CACCGTTACCGCTAA
NM_002948.3         CACCGTTACCGCTAA
NM_001253383.1      CACCGTTACCGCTAA
                    **************.

Pathways

Reactome : 3' -UTR-mediated translational regulation
Reactome : Cap-dependent Translation Initiation
Reactome : Disease
Reactome : Eukaryotic Translation Elongation
Reactome : Eukaryotic Translation Initiation
Reactome : Eukaryotic Translation Termination
Reactome : Formation of a pool of free 40S subunits
Reactome : GTP hydrolysis and joining of the 60S ribosomal subunit
Reactome : Gene Expression
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Influenza Viral RNA Transcription and Replication
Reactome : L13a-mediated translational silencing of Ceruloplasmin expression
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Metabolism of proteins
Reactome : Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC)
Reactome : Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC)
Reactome : Nonsense-Mediated Decay (NMD)
Reactome : Peptide chain elongation
Reactome : SRP-dependent cotranslational protein targeting to membrane
Reactome : Translation
Reactome : Viral mRNA Translation
WikiPathway : Cytoplasmic Ribosomal Proteins

Protein

UniProt : P61313
HPRD : 16043

Clone

Cloning Information : 7680
HIP Master Clone ID : 7238
Original Clone ID : FLH007680.01X

Organism


TAX_ID : 9606
Species Specific ID: 6138

Genome

Chromosome : 3
Map Location : 3p24.2
Ensembl : ENSG00000174748