DNASU Plasmid Repository • 480.965.5697 | Email

GRAP2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GRAP2
Gene Name:  GRB2-related adaptor protein 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH007257.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000955

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 993nts         Open reading frame : 1 to 993
Reference Sequence Alignment

ATGGAAGCTGTTGCCAAGTTTGATTTCACTGCTTCAGGTGAGGATGAACTGAGCTTTCAC
ACTGGAGATGTTTTGAAGATTTTAAGTAACCAAGAGGAGTGGTTTAAGGCGGAGCTTGGG
AGCCAGGAAGGATATGTGCCCAAGAATTTCATAGACATCCAGTTTCCCAAATGGTTTCAC
GAAGGCCTCTCTCGACACCAGGCAGAGAACTTACTCATGGGCAAGGAGGTTGGCTTCTTC
ATCATCCGGGCCAGCCAGAGCTCCCCAGGGGACTTCTCCATCTCTGTCAGGCATGAGGAT
GACGTTCAACACTTCAAGGTCATGCGAGACAACAAGGGTAATTACCTTCTGTGGACTGAG
AAGTTTCCATCCCTAAATAAGCTGGTAGACTACTACAGGACAAATTCCATCTCCAGACAG
AAGCAGATCTTCCTTAGAGACAGAACCCGAGAAGACCAGGGTCACCGGGGCAACAGCCTG
GACCGGAGGTCCCAGGGAGGCCCACACCTCAGTGGGGCTGTGGGAGAAGAAATCCGACCT
TCGATGAACCGGAAGCTGTCGGATCACCCCCCGACCCTTCCCCTGCAGCAGCACCAGCAC
CAGCCACAGCCTCCGCAATATGCCCCAGCGCCCCAGCAGCTGCAGCAGCCCCCACAGCAG
CGATATCTGCAGCACCACCATTTCCACCAGGAACGCCGAGGAGGCAGCCTTGACATAAAT
GATGGGCATTGTGGCACCGGCTTGGGCAGTGAAATGAATGCGGCCCTCATGCATCGGAGA
CACACAGACCCAGTGCAGCTCCAGGCGGCAGGGCGAGTGCGGTGGGCCCGGGCGCTGTAT
GACTTTGAGGCCCTGGAGGATGACGAGCTGGGGTTCCACAGCGGGGAGGTGGTGGAGGTC
CTGGATAGCTCCAACCCATCCTGGTGGACCGGCCGCCTGCACAACAAGCTGGGCCTCTTC
CCTGCCAACTACGTGGCACCCATGACCCGATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1185
Start on reference sequence 193
Mutations:
None
Discrepancy:
t346c,F116L; a849g
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GRAP2
Symbol Nomenclature : GRAP2
SYNONYM : GADS; GRAP-2; GRB2L; GRBLG; GRID; GRPL; GrbX; Grf40; Mona; P38
Designation : GRB-2-like protein|GRB2-related adapter protein 2|GRB2-related protein with insert domain|SH3-SH2-SH3 adapter Mona|SH3-SH2-SH3 adaptor molecule|adapter protein GRID|grf-40|grf40 adapter protein|growth factor receptor-binding protein|growth factor receptor-bound protein 2-related adaptor protein 2|hematopoietic cell-associated adapter protein GrpL|hematopoietic cell-associated adaptor protein GRPL
Full Nomenclature : GRB2-related adaptor protein 2
GENEID : 9402
Locus Tag : RP3-370M22.1
GI : 61367762
GenBank Accession : AY891115
HGNC : 4563
MIM : 604518
Vega : OTTHUMG00000151097
Target GenBank: NM_004810

 

Reference Sequence Alignment

  

HsCD00000955        ATGGAAGCTGTTGCCAAGTTTGATTTCACTGCTTCAGGTGAGGATGAACTGAGCTTTCAC
NM_004810.2         ATGGAAGCTGTTGCCAAGTTTGATTTCACTGCTTCAGGTGAGGATGAACTGAGCTTTCAC
XM_005261836.1      ATGGAAGCTGTTGCCAAGTTTGATTTCACTGCTTCAGGTGAGGATGAACTGAGCTTTCAC
                    ************************************************************

HsCD00000955        ACTGGAGATGTTTTGAAGATTTTAAGTAACCAAGAGGAGTGGTTTAAGGCGGAGCTTGGG
NM_004810.2         ACTGGAGATGTTTTGAAGATTTTAAGTAACCAAGAGGAGTGGTTTAAGGCGGAGCTTGGG
XM_005261836.1      ACTGGAGATGTTTTGAAGATTTTAAGTAACCAAGAGGAGTGGTTTAAGGCGGAGCTTGGG
                    ************************************************************

HsCD00000955        AGCCAGGAAGGATATGTGCCCAAGAATTTCATAGACATCCAGTTTCCCAAATGGTTTCAC
NM_004810.2         AGCCAGGAAGGATATGTGCCCAAGAATTTCATAGACATCCAGTTTCCCAAATGGTTTCAC
XM_005261836.1      AGCCAGGAAGGATATGTGCCCAAGAATTTCATAGACATCCAGTTTCCCAAATGGTTTCAC
                    ************************************************************

HsCD00000955        GAAGGCCTCTCTCGACACCAGGCAGAGAACTTACTCATGGGCAAGGAGGTTGGCTTCTTC
NM_004810.2         GAAGGCCTCTCTCGACACCAGGCAGAGAACTTACTCATGGGCAAGGAGGTTGGCTTCTTC
XM_005261836.1      GAAGGCCTCTCTCGACACCAGGCAGAGAACTTACTCATGGGCAAGGAGGTTGGCTTCTTC
                    ************************************************************

HsCD00000955        ATCATCCGGGCCAGCCAGAGCTCCCCAGGGGACTTCTCCATCTCTGTCAGGCATGAGGAT
NM_004810.2         ATCATCCGGGCCAGCCAGAGCTCCCCAGGGGACTTCTCCATCTCTGTCAGGCATGAGGAT
XM_005261836.1      ATCATCCGGGCCAGCCAGAGCTCCCCAGGGGACTTCTCCATCTCTGTCAGGCATGAGGAT
                    ************************************************************

HsCD00000955        GACGTTCAACACTTCAAGGTCATGCGAGACAACAAGGGTAATTACCTTCTGTGGACTGAG
NM_004810.2         GACGTTCAACACTTCAAGGTCATGCGAGACAACAAGGGTAATTACTTTCTGTGGACTGAG
XM_005261836.1      GACGTTCAACACTTCAAGGTCATGCGAGACAACAAGGGTAATTACTTTCTGTGGACTGAG
                    ********************************************* **************

HsCD00000955        AAGTTTCCATCCCTAAATAAGCTGGTAGACTACTACAGGACAAATTCCATCTCCAGACAG
NM_004810.2         AAGTTTCCATCCCTAAATAAGCTGGTAGACTACTACAGGACAAATTCCATCTCCAGACAG
XM_005261836.1      AAGTTTCCATCCCTAAATAAGCTGGTAGACTACTACAGGACAAATTCCATCTCCAGACAG
                    ************************************************************

HsCD00000955        AAGCAGATCTTCCTTAGAGACAGAACCCGAGAAGACCAGGGTCACCGGGGCAACAGCCTG
NM_004810.2         AAGCAGATCTTCCTTAGAGACAGAACCCGAGAAGACCAGGGTCACCGGGGCAACAGCCTG
XM_005261836.1      AAGCAGATCTTCCTTAGAGACAGAACCCGAGAAGACCAGGGTCACCGGGGCAACAGCCTG
                    ************************************************************

HsCD00000955        GACCGGAGGTCCCAGGGAGGCCCACACCTCAGTGGGGCTGTGGGAGAAGAAATCCGACCT
NM_004810.2         GACCGGAGGTCCCAGGGAGGCCCACACCTCAGTGGGGCTGTGGGAGAAGAAATCCGACCT
XM_005261836.1      GACCGGAGGTCCCAGGGAGGCCCACACCTCAGTGGGGCTGTGGGAGAAGAAATCCGACCT
                    ************************************************************

HsCD00000955        TCGATGAACCGGAAGCTGTCGGATCACCCCCCGACCCTTCCCCTGCAGCAGCACCAGCAC
NM_004810.2         TCGATGAACCGGAAGCTGTCGGATCACCCCCCGACCCTTCCCCTGCAGCAGCACCAGCAC
XM_005261836.1      TCGATGAACCGGAAGCTGTCGGATCACCCCCCGACCCTTCCCCTGCAGCAGCACCAGCAC
                    ************************************************************

HsCD00000955        CAGCCACAGCCTCCGCAATATGCCCCAGCGCCCCAGCAGCTGCAGCAGCCCCCACAGCAG
NM_004810.2         CAGCCACAGCCTCCGCAATATGCCCCAGCGCCCCAGCAGCTGCAGCAGCCCCCACAGCAG
XM_005261836.1      CAGCCACAGCCTCCGCAATATGCCCCAGCGCCCCAGCAGCTGCAGCAGCCCCCACAGCAG
                    ************************************************************

HsCD00000955        CGATATCTGCAGCACCACCATTTCCACCAGGAACGCCGAGGAGGCAGCCTTGACATAAAT
NM_004810.2         CGATATCTGCAGCACCACCATTTCCACCAGGAACGCCGAGGAGGCAGCCTTGACATAAAT
XM_005261836.1      CGATATCTGCAGCACCACCATTTCCACCAGGAACGCCGAGGAGGCAGCCTTGACATAAAT
                    ************************************************************

HsCD00000955        GATGGGCATTGTGGCACCGGCTTGGGCAGTGAAATGAATGCGGCCCTCATGCATCGGAGA
NM_004810.2         GATGGGCATTGTGGCACCGGCTTGGGCAGTGAAATGAATGCGGCCCTCATGCATCGGAGA
XM_005261836.1      GATGGGCATTGTGGCACCGGCTTGGGCAGTGAAATGAATGCGGCCCTCATGCATCGGAGA
                    ************************************************************

HsCD00000955        CACACAGACCCAGTGCAGCTCCAGGCGGCAGGGCGAGTGCGGTGGGCCCGGGCGCTGTAT
NM_004810.2         CACACAGACCCAGTGCAGCTCCAGGCGGCAGGGCGAGTGCGGTGGGCCCGGGCGCTGTAT
XM_005261836.1      CACACAGACCCAGTGCAGCTCCAGGCGGCAGGGCGAGTGCGGTGGGCCCGGGCGCTGTAT
                    ************************************************************

HsCD00000955        GACTTTGAGGCCCTGGAGGATGACGAGCTGGGGTTCCACAGCGGGGAGGTGGTGGAGGTC
NM_004810.2         GACTTTGAGGCCCTGGAGGATGACGAGCTGGGGTTCCACAGCGGGGAGGTGGTGGAGGTC
XM_005261836.1      GACTTTGAGGCCCTGGAGGATGACGAGCTGGGGTTCCACAGCGGGGAGGTGGTGGAGGTC
                    ************************************************************

HsCD00000955        CTGGATAGCTCCAACCCATCCTGGTGGACCGGCCGCCTGCACAACAAGCTGGGCCTCTTC
NM_004810.2         CTGGATAGCTCCAACCCATCCTGGTGGACCGGCCGCCTGCACAACAAGCTGGGCCTCTTC
XM_005261836.1      CTGGATAGCTCCAACCCATCCTGGTGGACCGGCCGCCTGCACAACAAGCTGGGCCTCTTC
                    ************************************************************

HsCD00000955        CCTGCCAACTACGTGGCACCCATGACCCGATTG
NM_004810.2         CCTGCCAACTACGTGGCACCCATGACCCGATAA
XM_005261836.1      CCTGCCAACTACGTGGCACCCATGACCCGATAA
                    *******************************:.

Pathways

NCI : JNK signaling in the CD4+ TCR pathway
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
Panther : PDGF signaling pathway
Panther : T cell activation
Reactome : Adaptive Immune System
Reactome : CD28 co-stimulation
Reactome : Costimulation by the CD28 family
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : FCERI mediated Ca+2 mobilization
Reactome : FCERI mediated MAPK activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Generation of second messenger molecules
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Signal Transduction
Reactome : Signaling by SCF-KIT
Reactome : TCR signaling
WikiPathway : TCR Signaling Pathway

Protein

SMART domain : SH2 : Src homology 2 domains
SMART domain : SH3 : Src homology 3 domains
UniProt : Q6FI14
UniProt : O75791
HPRD : 05156

Clone

Cloning Information : 7257
HIP Master Clone ID : 6815
Original Clone ID : FLH007257.01L

Organism


TAX_ID : 9606
Species Specific ID: 9402

Genome

Chromosome : 22
Map Location : 22q13.2
Ensembl : ENSG00000100351

Reagents

Labome : GRAP2-antibody