DNASU Plasmid Repository • 480.965.5697 | Email

DCN (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DCN
Gene Name:  decorin
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH007638.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000961

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1080nts         Open reading frame : 1 to 1080
Reference Sequence Alignment

ATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAA
CAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTT
CCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGC
CATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCC
CCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGAC
TTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTT
AGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAG
CTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAAT
GAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAA
CTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAG
AAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCT
CCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGC
CTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTT
GACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAG
CTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCAT
AACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAA
AAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAG
CCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1161
Start on reference sequence 82
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DCN
Symbol Nomenclature : DCN
SYNONYM : CSCD; DSPG2; PG40; PGII; PGS2; SLRR1B
Designation : PG-S2|bone proteoglycan II|decorin proteoglycan|dermatan sulphate proteoglycans II|proteoglycan core protein|small leucine-rich protein 1B
Full Nomenclature : decorin
GENEID : 1634
GI : 61357630
GenBank Accession : AY888475
HGNC : 2705
MIM : 125255
Vega : OTTHUMG00000169998
Target GenBank: NM_001920

 

Reference Sequence Alignment

  

HsCD00000961        ATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAA
XM_005268693.1      ATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAA
NM_001920.3         ATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAA
NM_133503.2         ATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAA
                    ************************************************************

HsCD00000961        CAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTT
XM_005268693.1      CAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTT
NM_001920.3         CAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTT
NM_133503.2         CAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTT
                    ************************************************************

HsCD00000961        CCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGC
XM_005268693.1      CCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGC
NM_001920.3         CCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGC
NM_133503.2         CCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGC
                    ************************************************************

HsCD00000961        CATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCC
XM_005268693.1      CATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCC
NM_001920.3         CATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCC
NM_133503.2         CATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCC
                    ************************************************************

HsCD00000961        CCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGAC
XM_005268693.1      CCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGAC
NM_001920.3         CCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGAC
NM_133503.2         CCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGAC
                    ************************************************************

HsCD00000961        TTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTT
XM_005268693.1      TTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTT
NM_001920.3         TTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTT
NM_133503.2         TTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTT
                    ************************************************************

HsCD00000961        AGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAG
XM_005268693.1      AGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAG
NM_001920.3         AGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAG
NM_133503.2         AGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAG
                    ************************************************************

HsCD00000961        CTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAAT
XM_005268693.1      CTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAAT
NM_001920.3         CTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAAT
NM_133503.2         CTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAAT
                    ************************************************************

HsCD00000961        GAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAA
XM_005268693.1      GAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAA
NM_001920.3         GAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAA
NM_133503.2         GAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAA
                    ************************************************************

HsCD00000961        CTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAG
XM_005268693.1      CTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAG
NM_001920.3         CTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAG
NM_133503.2         CTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAG
                    ************************************************************

HsCD00000961        AAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCT
XM_005268693.1      AAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCT
NM_001920.3         AAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCT
NM_133503.2         AAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCT
                    ************************************************************

HsCD00000961        CCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGC
XM_005268693.1      CCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGC
NM_001920.3         CCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGC
NM_133503.2         CCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGC
                    ************************************************************

HsCD00000961        CTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTT
XM_005268693.1      CTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTT
NM_001920.3         CTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTT
NM_133503.2         CTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTT
                    ************************************************************

HsCD00000961        GACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAG
XM_005268693.1      GACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAG
NM_001920.3         GACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAG
NM_133503.2         GACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAG
                    ************************************************************

HsCD00000961        CTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCAT
XM_005268693.1      CTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCAT
NM_001920.3         CTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCAT
NM_133503.2         CTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCAT
                    ************************************************************

HsCD00000961        AACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAA
XM_005268693.1      AACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAA
NM_001920.3         AACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAA
NM_133503.2         AACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAA
                    ************************************************************

HsCD00000961        AAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAG
XM_005268693.1      AAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAG
NM_001920.3         AAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAG
NM_133503.2         AAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAG
                    ************************************************************

HsCD00000961        CCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAG
XM_005268693.1      CCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAA
NM_001920.3         CCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAA
NM_133503.2         CCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAA
                    ***********************************************************.

Pathways

NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
Reactome : A tetrasaccharide linker sequence is required for GAG synthesis
Reactome : CS/DS degradation
Reactome : Chondroitin sulfate biosynthesis
Reactome : Chondroitin sulfate/dermatan sulfate metabolism
Reactome : Degradation of the extracellular matrix
Reactome : Dermatan sulfate biosynthesis
Reactome : Disease
Reactome : ECM proteoglycans
Reactome : Extracellular matrix organization
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : Heparan sulfate/heparin (HS-GAG) metabolism
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora

Protein

SMART domain : LRRNT : Leucine rich repeat N-terminal domain
UniProt : Q6FH10
UniProt : P07585
HPRD : 00501

Clone

Cloning Information : 7638
HIP Master Clone ID : 7196
Original Clone ID : FLH007638.01X

Organism


TAX_ID : 9606
Species Specific ID: 1634

Genome

Chromosome : 12
Map Location : 12q21.33
Ensembl : ENSG00000011465

Reagents

Labome : decorin-antibody