DNASU Plasmid Repository • 480.965.5697 | Email

CDC24 (Saccharomyces cerevisiae) in ZM552 (V5-tagged yeast expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDC24
Gene Name:  Guanine nucleotide exchange factor (GEF or GDP-release factor) for Cdc42p; required for polarity establishment and maintenance, and mutants have morphological defects in bud formation and shmooing
Sequence             
Original Clone ID: FLH463472.01X
Keyword: None
Species: Saccharomyces cerevisiae
Type: cDNA
Vector Name: ZM552               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
ScCD00098302

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2565nts         Open reading frame : 1 to 2565

ATGGCGATCCAAACCCGTTTTGCCTCGGGCACATCTTTATCCGATTTGAAACCAAAACCA
AGTGCAACTTCCATCTCCATACCCATGCAAAATGTCATGAACAAGCCTGTCACGGAACAG
GACTCACTGTTCCATATATGCGCAAACATCCGGAAAAGACTGGAGGTGTTACCTCAACTC
AAACCTTTTTTACAATTGGCCTACCAATCGAGCGAGGTTTTGAGTGAAAGGCAATCTCTT
TTGCTATCCCAAAAGCAGCATCAGGAACTGCTCAAGTCCAATGGCGCTAACCGGGACAGT
AGCGACTTGGCACCAACTTTAAGGTCTAGCTCTATCTCCACAGCTACCAGTCTCATGTCG
ATGGAAGGTATATCATACACGAATTCGAATCCCTCGGCCACCCCAAATATGGAGGACACT
TTACTGACTTTTAGTATGGGTATTTTGCCCATTACCATGGATTGCGACCCTGTGACACAA
CTATCACAGCTGTTTCAACAAGGTGCGCCCCTCTGTATACTTTTCAACTCTGTGAAGCCG
CAATTTAAATTACCGGTAATAGCATCTGACGATTTGAAAGTCTGTAAAAAATCCATTTAT
GACTTTATATTGGGCTGCAAGAAACACTTTGCATTTAACGATGAGGAGCTTTTCACTATA
TCCGACGTTTTTGCCAACTCTACTTCCCAGCTGGTCAAAGTGCTAGAAGTAGTAGAAACG
CTAATGAATTCCAGCCCTACTATTTTCCCCTCTAAGAGTAAGACACAGCAAATCATGAAC
GCAGAAAACCAACACCGACATCAGCCTCAGCAGTCTTCGAAGAAGCATAACGAGTATGTT
AAAATTATCAAGGAATTCGTTGCAACGGAAAGAAAATATGTTCACGATTTGGAAATTTTG
GATAAATATAGACAGCAGTTATTAGACAGCAATCTAATAACGTCTGAAGAGTTGTACATG
TTGTTCCCTAATTTGGGTGATGCTATAGATTTTCAAAGAAGATTTCTAATATCCTTGGAA
ATAAATGCTTTAGTAGAACCTTCCAAGCAAAGAATCGGGGCTCTTTTCATGCATTCCAAA
CATTTTTTTAAGTTGTATGAGCCTTGGTCTATTGGCCAAAATGCAGCCATCGAATTTCTC
TCTTCAACTTTGCACAAGATGAGGGTTGATGAATCGCAGCGGTTCATAATTAACAATAAA
CTGGAATTGCAATCCTTCCTTTATAAACCCGTGCAAAGGCTTTGTAGATATCCCCTGTTG
GTCAAAGAATTGCTTGCTGAATCGAGTGACGATAATAATACGAAAGAACTTGAAGCTGCT
TTAGATATTTCTAAAAATATTGCGAGAAGTATCAACGAAAATCAAAGAAGAACAGAAAAT
CATCAAGTGGTGAAGAAACTTTATGGTAGAGTGGTCAACTGGAAGGGTTATAGAATTTCC
AAGTTCGGTGAGTTATTATATTTCGATAAAGTGTTCATTTCAACAACAAATAGCTCCTCG
GAACCTGAAAGAGAATTTGAGGTTTATCTTTTTGAAAAAATCATCATCCTTTTTTCAGAG
GTAGTGACTAAGAAATCTGCATCATCACTAATCCTTAAGAAGAAATCCTCAACCTCAGCA
TCAATCTCCGCCTCGAACATAACGGACAACAATGGCAGCCCTCACCACAGTTACCATAAG
AGGCATAGCAATAGTAGTAGCAGTAATAATATCCATTTATCTTCGTCTTCAGCAGCGGCG
ATAATACATTCCAGTACCAATAGTAGTGACAACAATTCCAACAATTCATCATCATCCTCA
TTATTCAAGCTGTCCGCTAACGAACCTAAGCTGGATCTAAGAGGTCGAATTATGATAATG
AATCTGAATCAAATCATACCGCAAAACAACCGGTCATTAAATATAACATGGGAATCCATA
AAAGAGCAAGGTAATTTCCTTTTGAAATTCAAAAATGAGGAAACAAGAGATAATTGGTCA
TCGTGTTTACAACAGTTGATTCATGATCTGAAAAATGAGCAGTTTAAGGCAAGACATCAC
TCTTCAACATCGACGACTTCATCGACAGCCAAATCATCTTCAATGATGTCACCCACCACA
ACTATGAATACACCGAATCATCACAACAGCCGCCAGACACACGATAGTATGGCTTCTTTC
TCAAGTTCTCATATGAAAAGGGTTTCGGATGTCCTGCCTAAACGGAGGACCACTTCATCA
AGTTTCGAAAGTGAAATTAAATCCATTTCAGAAAATTTCAAGAACTCTATTCCAGAATCT
TCCATACTCTTCAGGATATCATATAATAACAACTCTAATAATACCTCTAGTAGCGAGATC
TTCACACTTTTGGTAGAAAAAGTTTGGAATTTTGACGACTTGATAATGGCGATCAATTCT
AAAATTTCGAATACACATAATAACAACATTTCACCAATCACCAAGATCAAATATCAGGAC
GAAGATGGGGATTTTGTTGTGTTAGGTAGCGATGAAGATTGGAATGTTGCTAAAGAAATG
TTGGCGGAAAACAATGAGAAATTCTTGAACATTCGTCTGTATTAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 2565
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  yeast    Marker:  LEU2
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: ZM552

ZM552 in advanced viewed

Synonyms: ZM552
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Yeast expression vector with N-terminal 3X V5 epitope tag; ampicillin resistance in bacteria; LEU2 resistance in yeast; Gateway cloning.
Comments: ZM511 Stu1 vector plus Gateway attR frame B cassette EcoRV fragment; same as ZM515. Cloning into the vector removes the ccdB cassette and chloramphenicol resistance.
Size (bp): 8302
Parent Vector: None
Empty Vector: EvNO00335423
Properties: Gateway, acceptor (destination), recombinational cloning, with tag/fusion/marker, yeast expression
Author Name: Zarmik Moqtaderi
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
primer site M13R M13 reverse sequencing primer 2630 2647
primer site M13F M13 forward sequencing primer 8286 8301
promoter CMD1 CMD1 promoter 295 484
recombination site attR1 attR1 recombinational cloning site 650 666
recombination site attR2 attR2 recombination site 2337 2352
reporter gene LacZ LacZ alpha gene 8146 8214
selectable marker CmR chloramphenicol resistance. removed with the ccdB cassette in clones with insert 883 1539
selectable marker LEU2 LEU2 selectable marker in yeast 5273 5344
selectable marker AmpR ampcillin resistance 3795 4454
tag V5 N-terminal triple V5 tag 494 631
trxn termination sequence CYC1 CYC1 terminator 2377 2582
yeast ARS ARS ARS yeast origin of replication 0 0
yeast centromere CEN yeast centromere 0 0

 

  • Gene
  • Protein
  • Clone
  • Organism

Gene

Target GenBank: AAC04990

 

Clone

Cloning Information : 463472
HIP Master Clone ID : 177700
Original Clone ID : FLH463472.01X

Organism


Species Specific ID: YAL041W