DNASU Plasmid Repository • 480.965.5697 | Email

GNAI1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GNAI1
Gene Name:  guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH020829.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000992

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1065nts         Open reading frame : 1 to 1065
Reference Sequence Alignment

ATGGGCTGCACGCTGAGCGCCGAGGACAAGGCGGCGGTGGAGCGGAGTAAGATGATCGAC
CGCAACCTCCGTGAGGACGGCGAGAAGGCGGCGCGCGAGGTCAAGCTGCTGCTGCTCGGT
GCTGGTGAATCTGGTAAAAGTACAATTGTGAAGCAGATGAAAATTATCCATGAAGCTGGT
TATTCAGAAGAGGAGTGTAAACAATACAAAGCAGTGGTCTACAGTAACACCATCCAGTCA
ATTATTGCTATCATTAGGGCTATGGGGAGGTTGAAGATAGACTTTGGTGACTCAGCCCGG
GCGGATGATGCACGCCAACTCTTTGTGCTAGCTGGAGCTGCTGAAGAAGGCTTTATGACT
GCAGAACTTGCTGGAGTTATAAAGAGATTGTGGAAAGATAGTGGTGTACAAGCCTGTTTC
AACAGATCCCGAGAGTACCAGCTTAATGATTCTGCAGCATACTATTTGAATGACTTGGAC
AGAATAGCTCAACCAAATTACATCCCGACTCAACAAGATGTTCTCAGAACTAGAGTGAAA
ACTACAGAAATTGTTGAAACCCATTTTACTTTCAAAGATCTTCATTTTAAAATGTTTGAT
GTGGGAGGTCAGAGATCTGAGCGGAAGAAGTGGATTCATTGCTTCGAAGGAGTGACGGCG
ATCATCTTCTGTGTAGCACTGAGTGACTACGACCTGGTTCTAGCTGAAGATGAAGAAATG
AACCGAATGCATGAAAGCATGAAATTGTTTGACAGCATATGTAACAACAAGTGGTTTACA
GATACATCCATTATACTTTTTCTAAACAAGAAGGATCTCTTTGAAGAAAAAATCAAAAAG
AGCCCTCTCACTATATGCTATCCAGAATATGCAGGATCAAACACATATGAAGAGGCAGCT
GCATATATTCAATGTCAGTTTGAAGACCTCAATAAAAGAAAGGACACAAAGGAAATATAC
ACCCACTTCACATGTGCCACAGATACTAAGAATGTGCAGTTTGTTTTTGATGCTGTAACA
GATGTCATCATAAAAAATAATCTAAAAGATTGTGGTCTCTTTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1077
Start on reference sequence 13
Mutations:
None
Discrepancy:
g548a,G183E
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GNAI1
Symbol Nomenclature : GNAI1
SYNONYM : Gi
Designation : Gi1 protein alpha subunit|adenylate cyclase-inhibiting G alpha protein|guanine nucleotide-binding protein G(i) subunit alpha-1
Full Nomenclature : guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1
GENEID : 2770
GI : 61367922
GenBank Accession : AY891138
HGNC : 4384
MIM : 139310
Vega : OTTHUMG00000023523
Target GenBank: NM_002069

 

Reference Sequence Alignment

  

HsCD00000992      ATGGGCTGCACGCTGAGCGCCGAGGACAAGGCGGCGGTGGAGCGGAGTAAGATGATCGAC
NM_006496.3       ATGGGCTGCACGTTGAGCGCCGAAGACAAGGCGGCAGTGGAGCGAAGCAAGATGATCGAC
NM_002069.5       ATGGGCTGCACGCTGAGCGCCGAGGACAAGGCGGCGGTGGAGCGGAGTAAGATGATCGAC
                  ************ **********.***********.********.** ************

HsCD00000992      CGCAACCTCCGTGAGGACGGCGAGAAGGCGGCGCGCGAGGTCAAGCTGCTGCTGCTCGGT
NM_006496.3       CGCAACTTACGGGAGGACGGGGAAAAAGCGGCCAAAGAAGTGAAGCTGCTGCTACTCGGT
NM_002069.5       CGCAACCTCCGTGAGGACGGCGAGAAGGCGGCGCGCGAGGTCAAGCTGCTGCTGCTCGGT
                  ****** *.** ******** **.**.***** ...**.** ***********.******

HsCD00000992      GCTGGTGAATCTGGTAAAAGTACAATTGTGAAGCAGATGAAAATTATCCATGAAGCTGGT
NM_006496.3       GCTGGAGAATCTGGTAAAAGCACCATTGTGAAACAGATGAAAATCATTCATGAGGATGGC
NM_002069.5       GCTGGTGAATCTGGTAAAAGTACAATTGTGAAGCAGATGAAAATTATCCATGAAGCTGGT
                  *****:************** **.********.*********** ** *****.*.*** 

HsCD00000992      TATTCAGAAGAGGAGTGTAAACAATACAAAGCAGTGGTCTACAGTAACACCATCCAGTCA
NM_006496.3       TATTCAGAGGATGAATGTAAACAATATAAAGTAGTTGTCTACAGCAATACTATACAGTCC
NM_002069.5       TATTCAGAAGAGGAGTGTAAACAATACAAAGCAGTGGTCTACAGTAACACCATCCAGTCA
                  ********.** **.*********** **** *** ******** ** ** **.*****.

HsCD00000992      ATTATTGCTATCATTAGGGCTATGGGGAGGTTGAAGATAGACTTTGGTGACTCAGCCCGG
NM_006496.3       ATCATTGCAATCATAAGAGCCATGGGACGGCTAAAGATTGACTTTGGGGAAGCTGCCAGG
NM_002069.5       ATTATTGCTATCATTAGGGCTATGGGGAGGTTGAAGATAGACTTTGGTGACTCAGCCCGG
                  ** *****:*****:**.** *****..** *.*****:******** **. *:***.**

HsCD00000992      GCGGATGATGCACGCCAACTCTTTGTGCTAGCTGGAGCTGCTGAAGAAGGCTTTATGACT
NM_006496.3       GCAGATGATGCCCGGCAATTATTTGTTTTAGCTGGCAGTGCTGAAGAAGGAGTCATGACT
NM_002069.5       GCGGATGATGCACGCCAACTCTTTGTGCTAGCTGGAGCTGCTGAAGAAGGCTTTATGACT
                  **.********.** *** *.*****  *******.. ************. * ******

HsCD00000992      GCAGAACTTGCTGGAGTTATAAAGAGATTGTGGAAAGATAGTGGTGTACAAGCCTGTTTC
NM_006496.3       CCAGAACTAGCAGGAGTGATTAAACGGTTATGGCGAGATGGTGGGGTACAAGCTTGCTTC
NM_002069.5       GCAGAACTTGCTGGAGTTATAAAGAGATTGTGGAAAGATAGTGGTGTACAAGCCTGTTTC
                   *******:**:***** **:**..*.**.***..****.**** ******** ** ***

HsCD00000992      AACAGATCCCGAGAGTACCAGCTTAATGATTCTGCAGCATACTATTTGAATGACTTGGAC
NM_006496.3       AGCAGATCCAGGGAATATCAGCTCAATGATTCTGCTTCATATTATCTAAATGATCTGGAT
NM_002069.5       AACAGATCCCGAGAGTACCAGCTTAATGATTCTGCAGCATACTATTTGAATGACTTGGAC
                  *.*******.*.**.** ***** ***********: **** *** *.*****  **** 

HsCD00000992      AGAATAGCTCAACCAAATTACATCCCGACTCAACAAGATGTTCTCAGAACTAGAGTGAAA
NM_006496.3       AGAATATCCCAGTCTAACTACATTCCAACTCAGCAAGATGTTCTTCGGACGAGAGTGAAG
NM_002069.5       AGAATAGCTCAACCAAATTACATCCCGACTCAACAAGATGTTCTCAGAACTAGAGTGAAA
                  ****** * **. *:** ***** **.*****.*********** .*.** ********.

HsCD00000992      ACTACAGAAATTGTTGAAACCCATTTTACTTTCAAAGATCTTCATTTTAAAATGTTTGAT
NM_006496.3       ACCACAGGCATTGTAGAAACACATTTCACCTTCAAAGACCTATACTTCAAGATGTTTGAT
NM_002069.5       ACTACAGGAATTGTTGAAACCCATTTTACTTTCAAAGATCTTCATTTTAAAATGTTTGAT
                  ** ****..*****:*****.***** ** ******** **: * ** **.*********

HsCD00000992      GTGGGAGGTCAGAGATCTGAGCGGAAGAAGTGGATTCATTGCTTCGAAGGAGTGACGGCG
NM_006496.3       GTAGGTGGCCAAAGATCAGAACGAAAAAAGTGGATTCACTGTTTTGAGGGAGTGACAGCA
NM_002069.5       GTGGGAGGTCAGAGATCTGAGCGGAAGAAGTGGATTCATTGCTTCGAAGGAGTGACGGCG
                  **.**:** **.*****:**.**.**.*********** ** ** **.********.**.

HsCD00000992      ATCATCTTCTGTGTAGCACTGAGTGACTACGACCTGGTTCTAGCTGAAGATGAAGAAATG
NM_006496.3       ATTATCTTCTGTGTGGCCCTCAGTGATTATGACCTTGTTCTGGCTGAGGACGAGGAGATG
NM_002069.5       ATCATCTTCTGTGTAGCACTGAGTGACTACGACCTGGTTCTAGCTGAAGATGAAGAAATG
                  ** ***********.**.** ***** ** ***** *****.*****.** **.**.***

HsCD00000992      AACCGAATGCATGAAAGCATGAAATTGTTTGACAGCATATGTAACAACAAGTGGTTTACA
NM_006496.3       AACCGAATGCATGAAAGCATGAAACTGTTTGACAGCATTTGTAATAACAAATGGTTTACA
NM_002069.5       AACCGAATGCATGAAAGCATGAAATTGTTTGACAGCATATGTAACAACAAGTGGTTTACA
                  ************************ *************:***** *****.*********

HsCD00000992      GATACATCCATTATACTTTTTCTAAACAAGAAGGATCTCTTTGAAGAAAAAATCAAAAAG
NM_006496.3       GAAACTTCAATCATTCTCTTCCTTAACAAGAAAGACCTTTTTGAGGAAAAAATAAAGAGG
NM_002069.5       GATACATCCATTATACTTTTTCTAAACAAGAAGGATCTCTTTGAAGAAAAAATCAAAAAG
                  **:**:**.** **:** ** **:********.** ** *****.********.**.*.*

HsCD00000992      AGCCCTCTCACTATATGCTATCCAGAATATGCAGGATCAAACACATATGAAGAGGCAGCT
NM_006496.3       AGTCCGTTAACTATCTGTTATCCAGAATACACAGGTTCCAATACATATGAAGAGGCAGCT
NM_002069.5       AGCCCTCTCACTATATGCTATCCAGAATATGCAGGATCAAACACATATGAAGAGGCAGCT
                  ** **  *.*****.** *********** .****:**.** ******************

HsCD00000992      GCATATATTCAATGTCAGTTTGAAGACCTCAATAAAAGAAAGGACACAAAGGAAATATAC
NM_006496.3       GCCTATATTCAATGCCAGTTTGAAGATCTGAACAGAAGAAAAGATACCAAGGAGATCTAT
NM_002069.5       GCATATATTCAATGTCAGTTTGAAGACCTCAATAAAAGAAAGGACACAAAGGAAATATAC
                  **.*********** *********** ** ** *.******.** **.*****.**.** 

HsCD00000992      ACCCACTTCACATGTGCCACAGATACTAAGAATGTGCAGTTTGTTTTTGATGCTGTAACA
NM_006496.3       ACTCACTTCACCTGTGCCACAGACACGAAGAATGTGCAGTTTGTTTTTGATGCTGTTACA
NM_002069.5       ACCCACTTCACATGTGCCACAGATACTAAGAATGTGCAGTTTGTTTTTGATGCTGTAACA
                  ** ********.*********** ** *****************************:***

HsCD00000992      GATGTCATCATAAAAAATAATCTAAAAGATTGTGGTCTCTTTTTG
NM_006496.3       GATGTCATCATTAAAAACAACTTAAAGGAATGTGGACTTTATTGA
NM_002069.5       GATGTCATCATAAAAAATAATCTAAAAGATTGTGGTCTCTTTTAA
                  ***********:***** **  ****.**:*****:** *:** .

Pathways

NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : Endothelins
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : LPA receptor mediated events
NCI : Nongenotropic Androgen signaling
NCI : PAR1-mediated thrombin signaling events
NCI : Plasma membrane estrogen receptor signaling
NCI : S1P1 pathway
NCI : S1P2 pathway
NCI : S1P3 pathway
NCI : S1P4 pathway
NCI : S1P5 pathway
NCI : SHP2 signaling
NCI : Sphingosine 1-phosphate (S1P) pathway
Panther : 5HT1 type receptor mediated signaling pathway
Panther : Dopamine receptor mediated signaling pathway
Panther : Endogenous cannabinoid signaling
Panther : Enkephalin release
Panther : GABA-B receptor II signaling
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Metabotropic glutamate receptor group II pathway
Panther : Metabotropic glutamate receptor group III pathway
Panther : Muscarinic acetylcholine receptor 2 and 4 signaling pathway
Panther : Nicotine pharmacodynamics pathway
Panther : Opioid prodynorphin pathway
Panther : Opioid proenkephalin pathway
Panther : Opioid proopiomelanocortin pathway
Reactome : ADP signalling through P2Y purinoceptor 12
Reactome : Activation of GABAB receptors
Reactome : Adenylate cyclase inhibitory pathway
Reactome : Adrenaline,noradrenaline inhibits insulin secretion
Reactome : G alpha (i) signalling events
Reactome : G alpha (s) signalling events
Reactome : G alpha (z) signalling events
Reactome : G-protein activation
Reactome : G-protein mediated events
Reactome : GABA B receptor activation
Reactome : GABA receptor activation
Reactome : GPCR downstream signaling
Reactome : Hemostasis
Reactome : Inhibition of adenylate cyclase pathway
Reactome : Integration of energy metabolism
Reactome : Metabolism
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Opioid Signalling
Reactome : PLC beta mediated events
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of insulin secretion
Reactome : Signal Transduction
Reactome : Signal amplification
Reactome : Signaling by GPCR
Reactome : Transmission across Chemical Synapses
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : G Protein Signaling Pathways
WikiPathway : Nicotine Activity on Dopaminergic Neurons
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Signal Transduction of S1P Receptor
WikiPathway : TSH signaling pathway

Protein

SMART domain : G_alpha : G protein alpha subunit
UniProt : P63096
HPRD : 00756

Clone

Cloning Information : 20829
HIP Master Clone ID : 38860
Original Clone ID : FLH020829.01L

Organism


TAX_ID : 9606
Species Specific ID: 2770

Genome

Chromosome : 7
Map Location : 7q21
Ensembl : ENSG00000127955

Reagents

Labome : GNAI1-antibody