Detailed Vector Information: pDONR201

Vector Name:
pDONR201
Synonyms:
''
Sequencing Primer:
Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description:
Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments:
The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp):
4470
Parent Vector:
None
Properties:
Gateway, donor (entry), recombinational cloning
Author Name:
Invitrogen
Publications:
None
Vector Map:
Vector Sequence:
Sequence:
DNA Vector Map
Powered by LabGenius

Vector Features:

Type
Name
Description
Start
End
bacterial origin
ColE
ColE1 (pUC-type) origin of replication (modified, low copy number)
3744
4426
negative selection marker
ccdB
ccdB negative selection gene (death cassette), LOST in recombined (with insert) form
1264
959
primer site
forward primer
recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3
300
324
primer site
reverse primer
recommended reverse primer site 5 gtaacatcagagattttgagacac 3
2769
2792
recombination site
attP1
attP recombination site 1 LOST in recombined (with insert) form
332
563
recombination site
attP2
attP recombination site 2 LOST in recombined (with insert) form
2744
2513
recombination site
attL1
attL recombination site 1 present in recombined (with insert) form only, position is approximate
332
563
recombination site
attL2
attL recombination site 2 present in recombined (with insert) form only, position is approximate
2744
2513
selectable marker
CmR
chloramphenicol resistance gene, LOST in recombined (with insert) form
2265
2513
selectable marker
KanR
kanamycin resistance gene
2868
3677
trxn termination sequence
rrn T2
rrn T2 transcription termination sequence
73
100
trxn termination sequence
rrn T1
rrn T1 transcription termination sequence
232
275