Detailed Vector Information: pANT7_cGST

Vector Name:
pANT7_cGST
Synonyms:
pANT7-cGST
Sequencing Primer:
Forward:  NAP150
Reverse:  NAP138R
Description:
with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments:
One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp):
5964
Parent Vector:
None
Properties:
Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name:
Joshua LaBaer
Al Lau
Niroshan Ramachandran
Publications:
PMID: 15232106
Title: Self-assembling protein microarrays
Vector Map:
Vector Sequence:
Sequence:
DNA Vector Map
Powered by LabGenius

Vector Features:

Type
Name
Description
Start
End
bacterial origin
ColE
ColE1 bacterial origin of replication
3931
3249
death cassette
ccdB
ccdB death cassette present in 'empty vector' form only (replace with gene of interest)
1876
2085
primer
NAP138
NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3?
2405
2384
primer
NAP150
Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3?
388
408
promoter
T7
T7 transcriptional start sequence
5940
5964
recombination site
attR1
AttR1 site for recombination in empty vector
549
565
recombination site
attR2
AttR2 site for recombination in empty vector
2236
2251
selectable marker
CmR
chloramphenicol resistance
782
1438
selectable marker
AmpR
ampicillin resistance gene
4688
4029
tag
GST
Glutathione transferase (GST) tag
2282
2950