Detailed Vector Information: pJP1520

Vector Name:
pJP1520
Synonyms:
''
Sequencing Primer:
Forward:  JPO113
Reverse:  Unknown
Description:
Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments:
One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp):
7894
Parent Vector:
None
Properties:
Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name:
Ed Harlow
Joseph Pearlberg
Publications:
None
Vector Map:
Vector Sequence:
Sequence:
DNA Vector Map
Powered by LabGenius

Vector Features:

Type
Name
Description
Start
End
bacterial origin
ori
bacterial origin of replication
5659
6341
gene fragment
gag/pol/env
non-functional gag/pol/env for packaging efficiency
1871
2644
primer
JPO113
forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG
3555
3581
primer site
PBSQ
primer binding sequence (glutamine tRNA primer binding site)
1140
1156
promoter
bacterial
bacterial promoter (for chlR ORF in Creator-type inserts)
3879
4005
recombination site
LoxP
LoxP site for recombinational cloning
3651
3684
selectable marker
AmpR
ampicillin resistance gene (beta-lactamase)
6237
7094
viral LTR
5p LTR
5p viral LTR (MPSV U3, R, U5)
550
1139
viral LTR
3p LTR
3p viral LTR (MPSV U3, R, U5)
3962
4551