DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pEU-His-FV

TOP

Vector Name: pEU-His-FV
       DyNA Vector Map

      Powered by LabGenius

Synonyms: None

pEU-His-FV

Sequencing Primer: Forward:  pEU319 Forward
Reverse:  pEU Reverse
Description: Cell-free expression vector, adds N-terminal 6xHis tag; amp resistance; restriction enzyme cloning (SgfI, PmeI).
Comments: Cloning into this vector will remove the BarCat casstte. To avoid, the toxicity of the barnase gene, the vector pEU-HSBC (EvNO00306667) can be ordered, which substitutes sacB for barnase.
Size (bp): 4966
Empty Vector: EvNO00084283
Parent Vector: None
Properties: cell-free expression, multiple cloning site, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 15782178
Title: Cell-free protein production and labeling protocol for NMR-based structural proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 2809 3491
gene fragment TMV-L TMV-L 278 2238
gene fragment Omega TMV Omega 397 520
gene fragment BarCat-cat BarCat cassette, including CAT 1010 1667
gene fragment BarCat-bar BarCat cassette, including Barnase 572 908
primer His2 forward His2 forward sequencing primer TCTTTCAAATACTTCTAGCTAGAGTA 424 449
promoter SP6 SP6 promoter 373 390
recombination site MCS pF1K (Flexi-Vector) homology domain 1675 1803
selectable marker AmpR ampicillin resistance gene 3589 4248
tag His 6xHis tag 527 544