DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pFASTBAC1-C-His-TOPO

TOP

Vector Name: pFASTBAC1-C-His-TOPO
       DyNA Vector Map

      Powered by LabGenius

Synonyms: pFB1-C-His-TOPO, pFB1-C-His-TOPO_KW

pFASTBAC1-C-His-TOPO

Sequencing Primer: Forward:  pFB forward
Reverse:  pFB reverse
Description: Baculovirus vector, adds C-terminal 6xHis tag and TEV protease site; amp resistance; TOPO cloning.
Comments: None
Size (bp): 4763
Empty Vector: None
Parent Vector: None
Properties: TOPO Cloning, baculovirus/insect cell expression, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation ATG (Met, Ala, Leu) 4065 4078
TOPO recognition site TOPO TOPO cloning site 4069 4078
bacterial origin ori pUC-type bacterial origin of replication 1544 2226
poly-A signal polyA SV40 polyA signal sequence 4189 4380
primer pFB reverse reverse sequencing primer: ACAAATGTGGTATGGCTGATT 4150 4170
primer pFB foward forward sequencing primer:  TATTCCGGATTATTCATACC 3995 4014
promoter PH polyhedrin promoter for insect cell expression 3904 4032
selectable marker AmpR ampicillin resistance gene 787 1446
selectable marker GenR gentamycin resistance gene 3000 3533
ssDNA origin f1 ori f1 origin 19 325
tag His C-terminal 6xHis and stop 4079 4096
transposon fragment Tn7R Tn7R transposon site 2709 2933
transposon fragment Tn7L Tn7L transposon site 1466 12