DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pGEn1-DEST

TOP

Vector Name: pGEn1-DEST
       DyNA Vector Map

      Powered by LabGenius

Synonyms: pXLG-NtermTCMhisStrep-DEST

pGEn1-DEST

Sequencing Primer: Forward:  pGEn3-DEST-5'F
Reverse:  pGEn1-DEST R
Description: Mammalian expression vector with a CMV promoter and N-terminal TCM 8xHis and Strep tag; ampicillin resistance in bacteria; Gateway recombinational cloning
Comments: None
Size (bp): 6210
Empty Vector: EvNO00534623
Parent Vector: None
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: University of Georgia
Kelley Moremen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE Col E1 origin 1137 1804
death cassette ccdB ccdB death cassette (removed in plasmids with insert) 4352 4657
intron artificial intron Artificial Intron 2828 2960
poly-A signal BGH pA bovine growth hormone (BGH) polyadenylation signal 5386 5600
primer forward forward primer 5? AGCATGCACCACCACCATCACC 3? 3049 3070
primer reverse reverse primer 5' TGACAACGGGCCACAACTCCTC 3' 5009 5030
promoter CMV CMV mammalian promoter 2208 2790
recombination site attR1 attR1 recombinational cloning site 3114 3242
recombination site 5'ITR inverted terminal repeat sequence 1998 2127
recombination site 3'-ITR inverted terminal repeat sequence 5688 5817
recombination site attR2 attR2 recombinational cloning site 4698 4822
selectable marker CmR Chloramphenicol resistance (CmR) gene (removed in plasmids with insert) 3351 4000
selectable marker AmpR ampicillin resistance gene 129 1108
signal sequence TCM TCM signal sequence 2977 3054
tag strep N-terminal Strep tag 3085 3108
tag His 8xHis tag 3055 3078
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 4838 5379