DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pGEn2-DEST

TOP

Vector Name: pGEn2-DEST
       DyNA Vector Map

      Powered by LabGenius

Synonyms: pXLG-NtermTCMhisAviGfp-DEST

pGEn2-DEST

Sequencing Primer: Forward:  pGEn2-DEST F
Reverse:  pGEn1-DEST R
Description: Mammalian expression vector with a CMV promoter and N-terminal 8xHis, AviTag, and Super GFP tags; ampicillin resistance in bacteria; Gateway recombinational cloning
Comments: None
Size (bp): 6930
Empty Vector: EvNO00534624
Parent Vector: None
Properties: Gateway, acceptor (destination), fluorescent marker, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: University of Georgia
Kelley Moremen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE Col E1 origin 1137 1804
death cassette ccdB ccdB death cassette (removed in plasmids with insert) 5072 5377
intron artificial intron artificial intron 2828 2960
poly-A signal BGH pA bovine growth hormone (BGH) polyadenylation signal 6106 6320
primer reverse reverse sequencing primer 5' TGACAACGGGCCACAACTCCTC 3' 5729 5750
primer forward forward sequencing primer 5? AGCATGCACCACCACCATCACC 3? 3049 3070
promoter CMV CMV promoter 2208 2790
recombination site 3'-ITR inverted terminal repeat sequence 6408 6537
recombination site attR2 attR2 recombinational cloning site 5418 5542
recombination site attR1 attR1 recombinational cloning site 3834 3962
recombination site 5'ITR inverted terminal repeat sequence 1998 2127
selectable marker CmR Chloramphenicol resistance (CmR) gene (removed in plasmids with insert) 4071 4720
selectable marker AmpR ampicillin resistance 129 1108
signal sequence TCM TCM signal sequence 2977 3052
tag AviTag AviTag 3079 3129
tag His N-terminal 8xHis tag 3055 3078
tag GFP N-terminal SuperGFP tag 3130 3825
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 5558 6099