Detailed Vector Information: pGEn2-DEST

Vector Name:
pGEn2-DEST
Synonyms:
pXLG-NtermTCMhisAviGfp-DEST
Sequencing Primer:
Forward:  pGEn2-DEST F
Reverse:  pGEn1-DEST R
Description:
Mammalian expression vector with a CMV promoter and N-terminal 8xHis, AviTag, and Super GFP tags; ampicillin resistance in bacteria; Gateway recombinational cloning
Comments:
None
Size (bp):
6930
Parent Vector:
None
Properties:
Gateway, acceptor (destination), fluorescent marker, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name:
University of Georgia
Kelley Moremen
Publications:
None
Vector Map:
Vector Sequence:
Sequence:
DNA Vector Map
Powered by LabGenius

Vector Features:

Type
Name
Description
Start
End
bacterial origin
ColE
Col E1 origin
1137
1804
death cassette
ccdB
ccdB death cassette (removed in plasmids with insert)
5072
5377
intron
artificial intron
artificial intron
2828
2960
poly-A signal
BGH pA
bovine growth hormone (BGH) polyadenylation signal
6106
6320
primer
forward
forward sequencing primer 5? AGCATGCACCACCACCATCACC 3?
3049
3070
primer
reverse
reverse sequencing primer 5' TGACAACGGGCCACAACTCCTC 3'
5729
5750
promoter
CMV
CMV promoter
2208
2790
recombination site
5'ITR
inverted terminal repeat sequence
1998
2127
recombination site
attR1
attR1 recombinational cloning site
3834
3962
recombination site
attR2
attR2 recombinational cloning site
5418
5542
recombination site
3'-ITR
inverted terminal repeat sequence
6408
6537
selectable marker
AmpR
ampicillin resistance
129
1108
selectable marker
CmR
Chloramphenicol resistance (CmR) gene (removed in plasmids with insert)
4071
4720
signal sequence
TCM
TCM signal sequence
2977
3052
tag
His
N-terminal 8xHis tag
3055
3078
tag
AviTag
AviTag
3079
3129
tag
GFP
N-terminal SuperGFP tag
3130
3825
trxn regulatory element
WPRE
woodchuck hepatitis post-transcriptional regulatory element
5558
6099