DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCPD_nGST-SBP_DC


Vector Name: pCPD_nGST-SBP_DC
       DyNA Vector Map

      Powered by LabGenius

Synonyms: pCPD9-GST, pCPD_GST


Sequencing Primer: Forward:  pCPD5698_F
Reverse:  pCPD6268_R
Description: Bacterial expression vector with a T7 promoter, N-terminal GST, Thrombin prtease cleavage site, SBP tag, and TEV protease cleavage site; ampicillin and chloamphenicol resistance in bacteria (CmR removed in clones with inserts); Gateway recombinational cloning.
Comments: One in a series of pCPD vectors made by J. Saul for E. coli protein expression at CPD.
Size (bp): 7710
Empty Vector: EvNO00412303
Parent Vector: None
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: Center for Personalized Diagnostics
Joshua LaBaer
Ji Qiu
Justin Saul
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 replication origin 1344 2026
death cassette ccdB death cassette (removed when insert is present) 5864 7518
death cassette 2 ccdB (BsrGI removed) ccdB death cassette with BsrGI restriction enzyme cleavage site removed (death cassette removed when insert is present) 7073 7378
primer pCPD6268_R reverse sequencing primer agccaactcagcttccttt 7598 7616
primer pCPD5698_F forward sequencing primer aattcatggacgagaagacc 5693 5712
promoter T7 T7 promoter 4911 4927
protease cleavage site Thrombin thrombin cleavage site 5674 5691
protease cleavage site TEV TEV protease cleavage site 5818 5838
repressor protein gene LacI LacI repressor 3438 4397
ribosome binding site RBS pET ribosome binding site 4984 4990
selectable marker AmpR ampicillin resistance gene 587 1246
selectable marker CmR chloramphenicol resistance (removed when insert is present) 6072 6728
tag GST GST tag 4999 5667
tag SBP Streptavidin Binding Peptide tag 5698 5811
trxn regulatory element lac operator lac operator sequence 4930 4952
trxn termination sequence T7 term T7 terminator 7368 7685