DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCPD_nMBP-SBP_DC


Vector Name: pCPD_nMBP-SBP_DC
       DyNA Vector Map

      Powered by LabGenius

Synonyms: pCPD9-MBP


Sequencing Primer: Forward:  pCPD5698_F
Reverse:  pCPD6268_R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, bacterial expression expression with pCPD5698_F and pCPD6268_R and MBP and Thrombin and SBP and TEV and ccdB and CmR and T7 term and LacI and AmpR and ColE and T7 and lac operator and RBS; chloramphenicol resistance in bacterial, ampicillin resistance in bacterial;
Comments: One in a series of pCPD vectors made by J. Saul for E. coli protein expression at CPD.
Size (bp): 8193
Empty Vector: EvNO00412304
Parent Vector: None
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: Joshua LaBaer
Center for Personalized Diagnostics
Ji Qiu
Justin Saul
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 replication origin 1344 2026
death cassette ccdB ccdB death cassette (removed in clones with insert) 6347 8001
primer pCPD6268_R reverse sequencing primer agccaactcagcttccttt 8079 8099
primer pCPD5698_F forward sequencing primer aattcatggacgagaagacc 6176 6195
promoter T7 T7 promoter 4911 4927
protease cleavage site Thrombin thrombin cleavage site 6157 6174
protease cleavage site TEV TEV protease cleavage site 6301 6321
repressor protein gene LacI LacI repressor 3438 4397
ribosome binding site RBS pET ribosome binding site 4984 4990
selectable marker CmR chloramphenicol resistance gene 6555 7211
selectable marker AmpR Ampicillin resistance gene 587 1246
tag SBP Streptavidin Binding Peptide tag 6181 6294
tag MBP maltose binding protein tag 4999 6150
trxn regulatory element lac operator LacO sequence 4930 4952
trxn termination sequence T7 term T7 terminator 8121 8168