DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_nHALO_DC


Vector Name: pJFT7_nHALO_DC
       DyNA Vector Map

      Powered by LabGenius

Synonyms: ''


Sequencing Primer: Forward:  HaloseqF
Reverse:  pANT1491R
Description: In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable HALO tag; ampicillin resistance; Gateway or Flexi cloning compatible
Comments: Modified from pANT7_cGST, can be used for either Gateway or Flexi cloning, contains Gateway Death Cassette
Size (bp): 6616
Empty Vector: EvNO00424503
Parent Vector: None
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Joshua LaBaer
Justin Saul
Fernanda Festa
Publications: PMID: 201200062
Title: A versatile protein microarray platform enabling antibody profiling against denatured proteins.

Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3451 4133
bacterial origin M13 Ori M13 origin 5527 5982
death cassette ccdB ccdB death cassette (removed in plasmids with an insert) 1483 3137
death cassette 2 ccdB (BsrGI removed) ccdB death cassette with BsrGI restriction site removed 2692 2997
enhancer CITE cap-independent translational enhancer (CITE) 17 515
primer HaloseqF HaloseqF forward sequencing primer aagcctgcctaactgcaa 1289 1306
primer NAP150 NAP150 forward sequencing primer cccattgtatgggatctgatc 388 408
primer pANT1491R pANT1491R reverse sequencing primer 3155 3176
primer M13 forward M13 forward sequencing primer 6126 6143
promoter T7 T7 promoter 6142 6166
protease cleavage site TEV TEV protease cleavage site (EDLYFQS) 1422 1442
recombination site attR1 attR1 recombinational cloning site 1458 1482
recombination site attR2 attR2 recombinational cloning site 3138 3162
reporter gene LacZ LacZ alpha gene 5987 6055
selectable marker AmpR ampicillin resistance gene 4231 4890
selectable marker CmR chloramphenicol resistance gene (removed in plasmids with an insert) 1691 2347
tag HALO N-terminal HALO tag 519 1409
trxn termination sequence T7 term T7 termination 3211 3229