DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pSGP18

TOP

Vector Name: pSGP18
       DyNA Vector Map

      Powered by LabGenius

Synonyms: None

pSGP18

Sequencing Primer: Forward:  pSGP18for
Reverse:  Unknown
Description: Yeast expression vector with a AOX1 promoter C-terminal CBP and RSG-6xHis tag with 3C protease cleavage site; zeocin resistance in Pichia and in bacteria; ligation independent cloning (LIC)
Comments: Similar to pSGP17 but without the prepro-alpha-factor signal sequence
Size (bp): 3424
Empty Vector: EvNO00430384
Parent Vector: None
Properties: expression in Pichia pastoris, ligation independent cloning (LIC), with tag/fusion/marker, yeast expression
Author Name: University of Rochester
Mark Dumont
PSI:Biology
Membrane Protein Structural Biology Consortium
Sara M Connelly
Publications: PMID: 16893193
Title: Purification and ATP hydrolysis of the putative cholesterol transporters ABCG5 and ABCG8

PMID: 17569508
Title: Expression of 25 human ABC transporters in the yeast Pichia pastoris and characterization of the purified ABCC3 ATPase activity

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin for bacterial replication 2738 3420
ligation independent cloning LIC LIC cloning site (using an inverted pair of BsmBI sites with a PstI site in between) 956 975
primer primer forward sequencing primer CACCTGTGCCGAAACGCAAATG 625 646
promoter AOX1 Pichia AOX1 promoter 7 935
protease cleavage site 3C 3C protease cleavage site 988 1011
selectable marker ZeoR Zeocin resistance gene 1994 2368
tag His C-terminal RGS-6xHis tag 1151 1168
tag CBP C-terminal calmodulin binding peptide (CBP) tag (start and end location estimated) 1012 1150