DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pNIC28-Bsa4

TOP

Vector Name: pNIC28-Bsa4
       DyNA Vector Map

      Powered by LabGenius

Synonyms: pSEC-His

pNIC28-Bsa4

Sequencing Primer: Forward:  pLICf
Reverse:  pLIC rev
Description: Bacterial expression vector with T7 promoter and N-terminal 6xHis tag with TEV protease cleavage site; kanamycin resistance in bacteria; ligation independent cloning
Comments: pET expression vector with His6 tag in 22-aa N-terminal fusion peptide, with TEV protease cleavage site. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose
Size (bp): 7284
Empty Vector: None
Parent Vector: None
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Opher Gileadi
Publications: PMID: 20541610
Title: High-throughput production of human proteins for crystallization: the SGC experience

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin f1 f1 origin 2266 2721
bacterial origin ColE ColE1 pBR322 origin 4338 4338
ligation independent cloning 3'LIC 2036 2050
ligation independent cloning 5'LIC 96 110
primer pLICrev pLIC reverse sequencing primer AGCAGCCAACTCAGCTTCC 2145 2164
primer pLICfor pLIC forward sequencing primer TGTGAGCGGATAACAATTCC 7262 7282
promoter T7 T7 promoter 7238 7254
protease cleavage site TEV TEV protease cleavage site 87 110
repressor binding site lac operator lac operator 7257 7281
repressor protein gene LacI Lac repressor gene 5772 6851
selectable marker KanR kanamycin resistance 2817 3629
selectable marker SacB SacB gene - allows for negative selection on 5% sucrose 569 1987
tag His N-terminal 6xHis tag 45 62
trxn termination sequence T7 term T7 terminator 2183 2229