DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pMCSG48

TOP

Vector Name: pMCSG48
       DyNA Vector Map

      Powered by LabGenius

Synonyms: None

pMCSG48

Sequencing Primer: Forward:  pMCSG48F
Reverse:  T7 terminator
Description: Bacterial expression vector with a T7 promoter and N-terminal 8xHis NusA tag, TEV cleavable; ampicillin resistance in bacteria; Ligation Independent cloning
Comments: None
Size (bp): 6741
Empty Vector: None
Parent Vector: None
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Midwest Center for Structural Genomics
PSI:Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence: Not Available

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin of replication 4735 4735
gene fragment NusA NusA cds 252 1710
ligation independent cloning LIC LIC site 205 234
primer forward primer Forward sequencing primer GAAGGGTTGACCGACGAAAAAGC 0 0
promoter T7 T7 promoter 2345 3304
protease cleavage site TEV TEV protease cleavage site 223 243
repressor protein gene LacI LacI cds 2345 3304
selectable marker AmpR Ampicillin resistance gene 5493 6353
tag His N-terminal 8xHis tag 1717 1740
trxn termination sequence T7 term T7 terminator 26 72