DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCMV(WT)


Vector Name: pCMV(WT)
       DyNA Vector Map

      Powered by LabGenius

Synonyms: WISP12-91


Sequencing Primer: Forward:  pcDNAF
Reverse:  pcDNAR
Description: Mammalian expression vector with a CMV promoter; ampicillin resistance in bacteria, neomycin resisatance in mammalian cells; restriction enzyme cloning
Comments: Empty vector Sundquist Lab internal database number = WISP12-91. Restriction enzyme cloning can be used with this vector - e.g. Xho1, Kpn1 works well
Size (bp): 5478
Empty Vector: EvNO00601609
Parent Vector: None
Properties: mammalian expression, multiple cloning site
Author Name: University of Utah
Wesley I. Sundquist
Eiji Morita
Jun Arii
Devin Christensen
Jorg Votteler
Publications: PMID: 22877307
Title: Attenuated protein expression vectors for use in siRNA rescue experiments

Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin 3705 4387
primer forward primer pcDNAF forward 5' sequencing primer AGAGAACCCACTGCTTACTGGCTTATC 831 857
primer reverse primer Reverse 3' sequencing primer pcDNAR AACTAGAAGGCACAGTCGAGGCTG 1066 1089
primer T7 T7 primer 863 882
promoter CMV Wildtype CMV promoter 210 830
selectable marker AmpR Ampicillin resistance 4485 5144
selectable marker NeoR Neomycin resistance (mammalian cells) 2186 2977
ssDNA origin f1 f1 origin 1362 1668