Detailed Vector Information: pCMV(WT)

Vector Name:
pCMV(WT)
Synonyms:
WISP12-91
Sequencing Primer:
Forward:  pcDNAF
Reverse:  pcDNAR
Description:
Mammalian expression vector with a CMV promoter; ampicillin resistance in bacteria, neomycin resisatance in mammalian cells; restriction enzyme cloning
Comments:
Empty vector Sundquist Lab internal database number = WISP12-91. Restriction enzyme cloning can be used with this vector - e.g. Xho1, Kpn1 works well
Size (bp):
5478
Parent Vector:
None
Properties:
mammalian expression, multiple cloning site
Author Name:
University of Utah
Wesley I. Sundquist
Eiji Morita
Jun Arii
Devin Christensen
Jorg Votteler
Publications:
PMID: 22877307
Title: Attenuated protein expression vectors for use in siRNA rescue experiments
Vector Map:
Vector Sequence:
Sequence:
DNA Vector Map
Powered by LabGenius

Vector Features:

Type
Name
Description
Start
End
bacterial origin
ColE
ColE1 bacterial origin
3705
4387
primer
forward primer
pcDNAF forward 5' sequencing primer AGAGAACCCACTGCTTACTGGCTTATC
831
857
primer
reverse primer
Reverse 3' sequencing primer pcDNAR AACTAGAAGGCACAGTCGAGGCTG
1066
1089
primer
T7
T7 primer
863
882
promoter
CMV
Wildtype CMV promoter
210
830
selectable marker
AmpR
Ampicillin resistance
4485
5144
selectable marker
NeoR
Neomycin resistance (mammalian cells)
2186
2977
ssDNA origin
f1
f1 origin
1362
1668