Detailed Vector Information: pCMV(delta1)

Vector Name:
pCMV(delta1)
Synonyms:
WISP12-92
Sequencing Primer:
Forward:  pcDNAF
Reverse:  pcDNAR
Description:
Mammalian expression vector with a deletion mutant of the CMV promoter; ampicillin resistance in bacteria, neomycin resistance in mammalian cells; restriction enzyme cloning
Comments:
Empty vector Sundquist Lab internal database number = WISP12-92. Restriction enzyme cloning can be used with this vector - e.g. Xho1, Kpn1 works well
Size (bp):
5161
Parent Vector:
Name: pCMV(WT)
Description: Vector containing the full length CMV promoter
Properties:
mammalian transduction, multiple cloning site
Author Name:
University of Utah
Wesley I. Sundquist
Eiji Morita
Jun Arii
Devin Christensen
Jorg Votteler
Publications:
PMID: 22877307
Title: Attenuated protein expression vectors for use in siRNA rescue experiments
Vector Map:
Vector Sequence:
Sequence:
DNA Vector Map
Powered by LabGenius

Vector Features:

Type
Name
Description
Start
End
bacterial origin
ColE
ColE1 origin
3388
4070
primer
forward primer
pcDNAF forward 5' sequencing primer AGAGAACCCACTGCTTACTGGCTTATC
749
771
primer
reverse primer
pcDNAR reverse 3' sequencing primer AACTAGAAGGCACAGTCGAGGCTG
514
540
promoter
T7
T7 promoter
546
565
promoter
CMV
truncated CMV promoter
234
598
selectable marker
AmpR
Ampicillin resistance
4168
4827
selectable marker
NeoR
Neomycin resistance (mammalian cells)
1869
2660
ssDNA origin
f1
f1 origin
1045
1351