DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCMV(delta1)

TOP

Vector Name: pCMV(delta1)
       DyNA Vector Map

      Powered by LabGenius

Synonyms: WISP12-92

pCMVdelta1

Sequencing Primer: Forward:  pcDNAF
Reverse:  pcDNAR
Description: Mammalian expression vector with a deletion mutant of the CMV promoter; ampicillin resistance in bacteria, neomycin resistance in mammalian cells; restriction enzyme cloning
Comments: Empty vector Sundquist Lab internal database number = WISP12-92. Restriction enzyme cloning can be used with this vector - e.g. Xho1, Kpn1 works well
Size (bp): 5161
Empty Vector: EvNO00601603
Parent Vector: Name: pCMV(WT)
Description: Vector containing the full length CMV promoter
Properties: mammalian transduction, multiple cloning site
Author Name: University of Utah
Eiji Morita
Jun Arii
Wesley I. Sundquist
Devin Christensen
Jorg Votteler
Publications: PMID: 22877307
Title: Attenuated protein expression vectors for use in siRNA rescue experiments

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3388 4070
primer forward primer pcDNAF forward 5' sequencing primer AGAGAACCCACTGCTTACTGGCTTATC 749 771
primer reverse primer pcDNAR reverse 3' sequencing primer AACTAGAAGGCACAGTCGAGGCTG 514 540
promoter CMV truncated CMV promoter 234 598
promoter T7 T7 promoter 546 565
selectable marker NeoR Neomycin resistance (mammalian cells) 1869 2660
selectable marker AmpR Ampicillin resistance 4168 4827
ssDNA origin f1 f1 origin 1045 1351