DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCMV(delta2)

TOP

Vector Name: pCMV(delta2)
       DyNA Vector Map

      Powered by LabGenius

Synonyms: WISP12-93

pCMVdelta2

Sequencing Primer: Forward:  pcDNAF
Reverse:  pcDNAR
Description: Mammalian expression vector with a deletion mutant of the CMV promoter; ampicillin resistance in bacteria, neomycin resistance in mammalian cells; restriction enzyme cloning
Comments: Empty vector Sundquist Lab internal database number = WISP12-93. Restriction enzyme cloning can be used with this vector - e.g. Xho1, Kpn1 works well
Size (bp): 5061
Empty Vector: EvNO00601604
Parent Vector: Name: pCMV(WT)
Description: Vector containing the full length CMV promoter
Properties: mammalian expression, multiple cloning site
Author Name: University of Utah
Eiji Morita
Jun Arii
Wesley I. Sundquist
Devin Christensen
Jorg Votteler
Publications: PMID: 22877307
Title: Attenuated protein expression vectors for use in siRNA rescue experiments

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3288 3970
primer forward pcDNAF forward 5' sequencing primer AGAGAACCCACTGCTTACTGGCTTATC 649 672
primer reverse primer pcDNAR reverse 3' sequencing primer AACTAGAAGGCACAGTCGAGGCTG 414 440
promoter CMV Truncated CMV promoter 234 498
selectable marker AmpR Ampicillin resistance 4068 4727
selectable marker NeoR neomycin resistance (mammalian cells) 1769 2560
ssDNA origin f1 f1 origin 945 1251