DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_n3xFlag-Halo_DC

TOP

Vector Name: pJFT7_n3xFlag-Halo_DC
       DyNA Vector Map

      Powered by LabGenius

Synonyms: None

pJFT7_n3xFlag-Halo_DC

Sequencing Primer: Forward:  HaloseqF
Reverse:  NAP138R
Description: In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable 3xFlag-Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: None
Size (bp): 6286
Empty Vector: EvNO00595407
Parent Vector: None
Properties: Gateway, acceptor (destination), blue/white selection, in vitro transcription, recombinational cloning
Author Name: Joshua LaBaer
Center for Personalized Diagnostics
Arizona State University
Ji Qiu
Fernanda Festa
Justin Saul
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin M13 Ori M13 origin 5647 6102
bacterial origin ColE ColE1 bacterial origin 3571 4253
death cassette ccdB Gateway ccdB death Cassette (DC) (removed in plasmids with inserts) 1558 3212
death cassette 2 ccdB (BsrGI removed) ccdb(bsrgi removed) 2767 3072
enhancer CITE CITE enhancer 17 515
primer forward primer HaloseqF aagcctgcctaactgcaa (used for sequencing the gene insert) 1364 1381
primer NAP150 NAP150F forward sequencing primer cccattgtatgggatctgatc (sequencing starts before the 3xFlag-HALO tag) 338 408
primer reverse primer cHaloseqR reverse sequencing primer CAACATCGACGTAGTGCAT 657 675
primer M13 forward M13 forward sequencing primer 6246 6263
primer T7 term primer T7 terminator primer 3331 3349
primer NAP138 NAP138r reverse sequencing primer tgtttcgccatttatcacctt 3272 3292
promoter T7 T7 promoter 6270 6286
protease cleavage site TEV TEV protease cleavage site EDLYFQS (used to separate expressed protein from 3xFlag-HALO tag) 1497 1517
recombination site attR2 attR2 recombinational cloning site 3213 3237
recombination site attR1 attR1 recombinational cloning site 1533 1557
reporter gene LacZ LacZ alpha 6107 6175
selectable marker AmpR Ampicillin resistance gene 4351 5010
selectable marker CmR Chloramphenicol resistance gene (removed in plasmids containing gene inserts) 1766 2422
ssDNA origin f1 f1 origin 5779 6085
tag HALO N-terminal HALO tag 597 1484
tag Flag N-terminal 3xFlag tag 546 590
trxn termination sequence T7 term T7 terminator 3342 3389