Detailed Vector Information: pJSP6_nGST_DC

Vector Name:
pJSP6_nGST_DC
Synonyms:
''
Sequencing Primer:
Forward:  GSTseqF
Reverse:  pF1KseqR
Description:
Wheat germ expression vector with a SP6 promoter and N-terminal TEV-cleavable GST tag; ampicillin resistance; Gateway or Flexi cloning compatible
Comments:
None
Size (bp):
6247
Parent Vector:
None
Properties:
Gateway, acceptor (destination), cell-free expression, recombinational cloning
Author Name:
Arizona State University
Joshua LaBaer
Justin Saul
Ji Qiu
Fernanda Festa
Center for Personalized Diagnostics
Publications:
None
Vector Map:
Vector Sequence:
Sequence:
DNA Vector Map
Powered by LabGenius

Vector Features:

Type
Name
Description
Start
End
bacterial origin
ColE
ColE1 origin
3701
4383
death cassette
ccdB
Gateway ccdB death Cassette (DC) (removed in plasmids with inserts)
883
2537
death cassette 2
ccdB (BsrGI removed)
ccdB (BsrGI removed)
2092
2397
enhancer
TMV Omega
TMV Omega enhancer
9
131
primer
reverse primer
pF1KseqR reverse sequencing primer CTTTCGGGCTTTGTTAGCAG (will sequence the insert)
2635
2654
primer
M13 reverse
M!3 reverse sequencing primer
3313
3333
primer
forward primer
GSTseqF forward sequencing primer gcaagtatatagcatggcct (used to sequence the insert)
718
737
promoter
SP6
SP6 promoter
6231
3
protease cleavage site
TEV
TEV protease cleavage site EDLYFQS (used to separate expressed protein from GST)
822
842
recombination site
attR2
attR2 recombination site
2538
2555
recombination site
attR1
attR1 recombination site
865
882
ribosome binding site
RBS
pet RBS
4904
4910
selectable marker
AmpR
ampicillin resistance gene
4481
5140
selectable marker
CmR
Chloramphenicol resistance gene (removed in plasmids containing gene inserts)
1091
1747
tag
GST
N-terminal GST
138
803