DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_nHIS_cHalo_DC


Vector Name: pJFT7_nHIS_cHalo_DC
       DyNA Vector Map

      Powered by LabGenius

Synonyms: ''


Sequencing Primer: Forward:  NAP150
Reverse:  cHaloseqR
Description: In vitro expression vector with a T7 promoter and N-terminal HIS and C-terminal TEV-cleavable Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: None
Size (bp): 6232
Empty Vector: EvNO00595403
Parent Vector: None
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Joshua LaBaer
Justin Saul
Ji Qiu
Fernanda Festa
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3511 4193
death cassette ccdB (BsrGI removed) ccdB death cassette (removed in plasmids that contain an insert) 1786 2091
enhancer CITE CITE enhancer 17 515
primer reverse primer cHaloseqR reverse sequencing primer CAACATCGACGTAGTGCAT 2372 2390
primer forward primer nap150f forward sequencing primer cccattgtatgggatctgatc 388 408
promoter T7 T7 promoter 6210 6226
protease cleavage site TEV TEV protease cleavage site (removes Halo tag) 2279 2299
recombination site attR1 attR1 recombinational cloning site 552 576
recombination site attR2 attR2 recombinational cloning site 2232 2256
selectable marker AmpR ampicillin resistance 4291 4950
selectable marker CmR chloramphenicol resistance (removed in plasmids containing an insert) 785 1441
ssDNA origin f1 f1 origin 5719 6025
tag HALO C-terminal Halo tag 2315 3199
tag His N-terminal 6xHis tag 525 542
trxn termination sequence T7 term T7 transcriptional terminator 3282 3329