DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pFab007

Vector Name: pFab007
       DyNA Vector Map

      Powered by LabGenius

Synonyms: None

Sequencing Primer: Forward:  Unknown
Reverse:  Unknown
Description: Recombinant antibody expression vector with STII periplasm export sequences; ampicillin resistance in bacteria
Comments: None
Size (bp): 5214
Empty Vector: None
Parent Vector: None
Properties: bacterial expression, with tag/fusion/marker
Author Name: University of Chicago
Recombinant Antibody Network
Publications: None
Vector Map:         Vector Sequence:

Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 4336 4128
primer forward primer For heavy chain CDRs: FabHCupF: 5 GGACGCATCGTGGCCC 3 1571 1586
primer site forward light chain CDR: FabLCupF: 5 CTGTCATAAAGTTGTCACGG 3 688 707
promoter T7 T7 promoter 3115 3142
secretion signal sequence STII STII periplasm export sequence 804 873
selectable marker AmpR ampicillin resistance 4226 4885
ssDNA origin f1 f1 origin 135 441
tag V5 V5 epitope tag 2428 2469