Detailed Vector Information: pFab007

Vector Name:
pFab007
Synonyms:
''
Sequencing Primer:
Forward:  Unknown
Reverse:  Unknown
Description:
Recombinant antibody expression vector with STII periplasm export sequences; ampicillin resistance in bacteria
Comments:
None
Size (bp):
5214
Parent Vector:
None
Properties:
bacterial expression, with tag/fusion/marker
Author Name:
University of Chicago
Recombinant Antibody Network
Publications:
None
Vector Map:
Vector Sequence:
Sequence:
DNA Vector Map
Powered by LabGenius

Vector Features:

Type
Name
Description
Start
End
bacterial origin
ColE
ColE1 origin
4336
4128
primer
forward primer
For heavy chain CDRs: FabHCupF: 5 GGACGCATCGTGGCCC 3
1571
1586
primer site
forward
light chain CDR: FabLCupF: 5 CTGTCATAAAGTTGTCACGG 3
688
707
promoter
T7
T7 promoter
3115
3142
secretion signal sequence
STII
STII periplasm export sequence
804
873
selectable marker
AmpR
ampicillin resistance
4226
4885
ssDNA origin
f1
f1 origin
135
441
tag
V5
V5 epitope tag
2428
2469