DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pCDF-BAD

TOP

Vector Name: pCDF-BAD
       DyNA Vector Map

      Powered by LabGenius

Synonyms: None

pCDF-BAD

Sequencing Primer: Forward:  ARAC5R
Reverse:  T7 terminator
Description: Arabinose-inducible expression in bacteria; spectinomycin resistance in bacteria; ligation into multiple cloning site downstream of RBS: NdeI, XhoI/SciI, AscI, ZraI/AatII; or just upstream of RBS: EagI/NotI, PmeI
Comments: For arabinose-inducible expression of the insert, on a vector that is compatible with most other cloning vectors (non-ColE1 origin of replication; Clone by ligation into multiple cloning site downstream of RBS: NdeI, XhoI/SciI, AscI, ZraI/AatII; or just upstream of RBS: EagI/NotI, PmeI
Size (bp): 3552
Empty Vector: EvNO00631285
Parent Vector: None
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Arizona State University
Debra T. Hansen
Jeffrey L. Hansen
Thirumagal Thiyagarajan
Medical University of South Carolina
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin CloDF13 CloDF13 origin 2792 3530
primer forward primer ARAC5R forward sequencing primer GGGATCATTTTGCGCTTCAG 694 683
promoter araC promoter araC promoter 1138 1166
promoter arabinose BAD arabinose BAD promoter 1263 1290
repressor binding site arabinose O2 operator arabinose O2 operator 1016 1033
repressor protein gene araC araC 109 987
ribosome binding site RBS ribosome binding site 2658 2662
selectable marker SpectR Spectinomycin, streptomycin resistance 2717 2722
trxn termination sequence T7 term T7 terminator 1643 1690