Gene 1: |
Gene Symbol:
Heavy chain Gene Name:  Heavy chain |
---|---|
Gene 2: |
Gene Symbol:
Light chain Gene Name:  Light chain Sequence |
Original Clone ID: | anti-SMARCE1-RAB-S20 |
Keyword: | anti-SMARCE1-RAB-S20 recombinant antibody fab fragment |
Species: | Homo sapiens |
Type: | cDNA |
Vector Name: | pFab007 Format: FUSION |
Source: | Recombinant Antibody Network |
Description: | None |
Comments: | None |
Mutation/ Discrepancy : |
No / No |
Publications: | None |
Authors: |
University of California San Francisco Recombinant Antibody Network Protein Capture Reagents Program |
HsCD00601582 Price: Login for Pricing AVAILABLE No restriction Special MTA: SPTA |
Insert sequence: 255nts
Open reading frame : 1 to 255 & 1 to 255
ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAAC
GCGTACGCTGAGATCTCCGAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCA
GGGGGCTCACTCCGTTTGTCCTGTGCAGCTTCTGGCTTCAACCTCTATTCTTATTCTATG
CACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCATATATTTCTTCTTAT
TCTGGCTCTACTTCT
ATGAAATACCTATTGCCTACGGCAGCCGCTGGCTTGCTGCTGCTGGCGGCCCAGCCGGCC
ATGGCGTCCGATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGAT
AGGGTCACCATCACCTGCCGTGCCAGTCAGTCCGTGTCCAGCGCTGTAGCCTGGTATCAA
CAGAAACCAGGAAAAGCTCCGAAGCTTCTGATTTACTCGGCATCCAGCCTCTACTCTGGA
GTCCCTTCTCGCTTC
|
Coding Sequence Details | |
---|---|
Insert Sequence Verified?: Y | Verification Method: Sequence Verification |
Mutations: None |
Discrepancy: None |
5' Linker Sequence: None | |
3' Linker Sequence: None |
Distributed in bacterial strain : | DH5-alpha T1 phage resistant |
---|---|
Antibiotic Selection: |
Host Type:
bacterial
Marker:
ampicillin Bacterial Selection Condition: 100 ug/mL ampicillin Growth Condition: Growth with the single antibiotic in LB at 37 degrees is recommended. Comments: Commonly used conditions for ampicillin resistant plasmid clones. |
Protein Expression Results: | None |
Recommended expression in: | Not Applicable |
  Powered by LabGenius |
||
Vector Name: | pFab007 | |
Synonyms: | '' | |
Description: | Recombinant antibody expression vector with STII periplasm export sequences; ampicillin resistance in bacteria | |
Comments: | None | |
Size (bp): | 5214 | |
Parent Vector: | None | |
Empty Vector: | None | |
Properties: | bacterial expression, with tag/fusion/marker | |
Author Name: |
University of Chicago Recombinant Antibody Network |
|
Publications: | None | |
Vector Map: |
![]() ![]() |
|
Sequence: |
Vector Features:
Type | Name | Description | Start Position | End Position |
---|---|---|---|---|
bacterial origin | ColE | ColE1 origin | 4336 | 4128 |
primer | forward primer | For heavy chain CDRs: FabHCupF: 5 GGACGCATCGTGGCCC 3 | 1571 | 1586 |
primer site | forward | light chain CDR: FabLCupF: 5 CTGTCATAAAGTTGTCACGG 3 | 688 | 707 |
promoter | T7 | T7 promoter | 3115 | 3142 |
secretion signal sequence | STII | STII periplasm export sequence | 804 | 873 |
selectable marker | AmpR | ampicillin resistance | 4226 | 4885 |
ssDNA origin | f1 | f1 origin | 135 | 441 |
tag | V5 | V5 epitope tag | 2428 | 2469 |
- Protein
- Clone
Protein
PCRP Binder Details : | anti-SMARCE1-RAB-S20 |
---|
Clone
Cloning Information : | 662855 |
---|---|
Original Clone ID : | anti-SMARCE1-RAB-S20 |