DNASU Plasmid Repository • 480.965.5697 | Email

Plasmid Collections


Collection: Human 3`UTRome v1 collection (Gateway Entry vector)

Description: The h3`UTRome v1 (1,461 human 3`UTRs) is a genomic clone collection of human 3`UTRs. The 3`UTRs were cloned from genomic DNA, extracted from the B-lymphocyte cell line GM12878. The 3`UTRs contain gene specific STOP codons at their 5`ends, and at their 3`ends each clone extends 150nt downstream of the annotated end of the transcript (GRCh37/hg19 Feb. 2009). All these 3`UTRs are cloned into the Gateway Entry vector P2RP3, and each insert has been sequence verified by Sanger sequencing. Please cite: Kotagama, K., Babb, C.S., Wolter, J.M., Murphy, R.P. and Mangone, M. "A human 3'UTR clone collection to study post-transcriptional gene regulation". BMC Genomics 16, 1036 (2015).
Total number of clones in the collection: 1456
Price: $ 5096.0 ($3.50 per clone)
Use Restriction: No restriction

To request individual clones from the collection, view the list and click "add to cart" (far right-hand side of the table) to add individual clones to your cart.


List of clones:

Explanation of Terms
  Clone ID Clone
Keywords Reference
Vector Selection
1 HsUT00697944 Plasmid Details 3'UTR MSL3L1 male-specific lethal 3 homolog (Drosophila) Sequence Verified: Yes; 3'UTR length: 2348; Forward Primer: TGCCAGGCATGGTGCTGA; Reverse Primer: AATACACTAAAAACTACTGGATTGAACTGT NM_078628 No/No NA P2RP3 bacterial: kanamycin
2 HsUT00697945 Plasmid Details 3'UTR RIOK3 RIO kinase 3 Sequence Verified: Yes; 3'UTR length: 2036; Forward Primer: GGAGACCCACCACTACTATATGATGAATAG; Reverse Primer: GGCCATTTGCGATTGAAATCTAACAATGAG NM_003831 No/No NA P2RP3 bacterial: kanamycin
3 HsUT00697946 Plasmid Details 3'UTR ZNF649 zinc finger protein 649 Sequence Verified: Yes; 3'UTR length: 1563; Forward Primer: GCCCACATCCTGCATTCATGA; Reverse Primer: AAAGTACCCAAAGATAAATGGAGTTTGGAA NM_023074 No/No NA P2RP3 bacterial: kanamycin
4 HsUT00697947 Plasmid Details 3'UTR CSRP1 cysteine and glycine-rich protein 1 Sequence Verified: Yes; 3'UTR length: 1363; Forward Primer: TTGGTCCACTCTGAGTGA; Reverse Primer: TTGAGTCAGAATTTCACCATGTTAGCCA NM_004078 No/No NA P2RP3 bacterial: kanamycin
5 HsUT00697948 Plasmid Details 3'UTR ZNF821 zinc finger protein 821 Sequence Verified: Yes; 3'UTR length: 1170; Forward Primer: TAACCATCCAAAATGTTTCCTTTCCAGTGA; Reverse Primer: ATAAGGACCTCTGCTTGGACAG NM_001201556 No/No NA P2RP3 bacterial: kanamycin
6 HsUT00697949 Plasmid Details 3'UTR ACO1 aconitase 1, soluble Sequence Verified: Yes; 3'UTR length: 903; Forward Primer: ATCCGCAAGATGGCCAAGTAG; Reverse Primer: CGTTATACCCGTACAGTTCTGATAGAGTTG NM_002197 No/No NA P2RP3 bacterial: kanamycin
7 HsUT00697950 Plasmid Details 3'UTR FGR FGR proto-oncogene, Src family tyrosine kinase Sequence Verified: Yes; 3'UTR length: 804; Forward Primer: CCCGGGGATCAGACATAG; Reverse Primer: CTCTGGGTGTTCTAAAACTCCACAC NM_001042747 No/No NA P2RP3 bacterial: kanamycin
8 HsUT00697951 Plasmid Details 3'UTR MSC musculin Sequence Verified: Yes; 3'UTR length: 1299; Forward Primer: CTATGTGGAACCACCGCTTAA; Reverse Primer: TAAAGAATGACGTTTGGAAATGGAGTGATC NM_005098 No/No NA P2RP3 bacterial: kanamycin
9 HsUT00697952 Plasmid Details 3'UTR ETS2 v-ets avian erythroblastosis virus E26 oncogene homolog 2 Sequence Verified: Yes; 3'UTR length: 2245; Forward Primer: CCCGACACGGAGGACTGA; Reverse Primer: CTAAGTGACTTGTGTATAAACCAGTTAAAC NM_001256295 No/No NA P2RP3 bacterial: kanamycin
10 HsUT00697953 Plasmid Details 3'UTR ZFP161 zinc finger and BTB domain containing 14 Sequence Verified: Yes; 3'UTR length: 2019; Forward Primer: GAGACGATAGCCTGTAGCTAG; Reverse Primer: GGTTACCACCATGACTATGTGGTTTCAAAG NM_003409 No/No NA P2RP3 bacterial: kanamycin
11 HsUT00697954 Plasmid Details 3'UTR PABPC1 poly(A) binding protein, cytoplasmic 1 Sequence Verified: Yes; 3'UTR length: 1562; Forward Primer: ACCGGTGTTCCAACTGTTTAA; Reverse Primer: ATTGTCTTGTGCCTTTTACATAAAACCAAT NM_002568 No/No NA P2RP3 bacterial: kanamycin
12 HsUT00697955 Plasmid Details 3'UTR MED31 mediator complex subunit 31 Sequence Verified: Yes; 3'UTR length: 1334; Forward Primer: CAACAGCAAAATAACACATCGGGAAAATGA; Reverse Primer: CCATGAACCTTTAGTTTGCCTGTAATACAT NM_016060 No/No NA P2RP3 bacterial: kanamycin
13 HsUT00697956 Plasmid Details 3'UTR ZNF552 zinc finger protein 552 Sequence Verified: Yes; 3'UTR length: 1138; Forward Primer: CAGAGAGTTCACAAAAGAAAGGGCTTATGA; Reverse Primer: AAACACAAGCAGCAACTCAAATATCCATAA NM_024762 No/No NA P2RP3 bacterial: kanamycin
14 HsUT00697957 Plasmid Details 3'UTR GREB1 growth regulation by estrogen in breast cancer 1 Sequence Verified: Yes; 3'UTR length: 902; Forward Primer: GCACATCAAATACGAAATCCGGACGTATAA; Reverse Primer: AAGTTGGAAAGACAATTTTTCAAAAAGCCA NM_033090 No/No NA P2RP3 bacterial: kanamycin
15 HsUT00697958 Plasmid Details 3'UTR MARK3 MAP/microtubule affinity-regulating kinase 3 Sequence Verified: Yes; 3'UTR length: 782; Forward Primer: TCCAAAATTGCCAATGAGCTAAAGCTGTAA; Reverse Primer: CTCTTTATTGCCTTGGGAGAAAAAATATGC NM_001128921 No/No NA P2RP3 bacterial: kanamycin
16 HsUT00697959 Plasmid Details 3'UTR ZNF639 zinc finger protein 639 Sequence Verified: Yes; 3'UTR length: 1290; Forward Primer: CCAGTCCATGAGACAACTTGA; Reverse Primer: TCCTTCCCCCACAACCCTC NM_016331 No/No NA P2RP3 bacterial: kanamycin
17 HsUT00697960 Plasmid Details 3'UTR CHD6 chromodomain helicase DNA binding protein 6 Sequence Verified: Yes; 3'UTR length: 2243; Forward Primer: CTCAAAGACTCCAACAACGACACCAATTAG; Reverse Primer: AACATACAGATTCCATAAGGATAACAAGGG NM_032221 No/No NA P2RP3 bacterial: kanamycin
18 HsUT00697961 Plasmid Details 3'UTR ZNF90 zinc finger protein 90 Sequence Verified: Yes; 3'UTR length: 1988; Forward Primer: TACATAGTGAAGAACATGGCAAATCTTTGA; Reverse Primer: GGCAGGAGAATCGCTTGAACTTG NM_007138 No/No NA P2RP3 bacterial: kanamycin
19 HsUT00697962 Plasmid Details 3'UTR ZNF182 zinc finger protein 182 Sequence Verified: Yes; 3'UTR length: 1496; Forward Primer: AAGTCAAAGTTCATGGCACATTAG; Reverse Primer: GTGCCTCTGGAATTGATTGAATAACTGTTG NM_006962 No/No NA P2RP3 bacterial: kanamycin
20 HsUT00697963 Plasmid Details 3'UTR SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 16kDa Sequence Verified: Yes; 3'UTR length: 1289; Forward Primer: GGGGGTCCTAGGCGATAA; Reverse Primer: ATTTAAGCCACCCACATCCTCAGTT NM_006938 No/No NA P2RP3 bacterial: kanamycin
21 HsUT00697964 Plasmid Details 3'UTR SLTM SAFB-like, transcription modulator Sequence Verified: Yes; 3'UTR length: 1134; Forward Primer: CCTCCGCGACGATTCTGA; Reverse Primer: CTACTGAGGTGAAGAGTCTAAGCTAGATTT NM_001013843 No/No NA P2RP3 bacterial: kanamycin
22 HsUT00697965 Plasmid Details 3'UTR HOXA4 homeobox A4 Sequence Verified: Yes; 3'UTR length: 898; Forward Primer: CCCGTTCCCTCCTCCATATAA; Reverse Primer: CATACATACACACACTCTCACACACAAATT NM_002141 No/No NA P2RP3 bacterial: kanamycin
23 HsUT00697966 Plasmid Details 3'UTR THRA thyroid hormone receptor, alpha Sequence Verified: Yes; 3'UTR length: 761; Forward Primer: GTCTTTGAGGATCAGGAAGTCTAA; Reverse Primer: TGGGGGCATTTCTCTCTGATGT NM_199334 No/No NA P2RP3 bacterial: kanamycin
24 HsUT00697967 Plasmid Details 3'UTR ZFHX2 zinc finger homeobox 2 Sequence Verified: Yes; 3'UTR length: 1287; Forward Primer: ACGACTACCTCTACACTTCTAGCTTTATAA; Reverse Primer: CATCGGCCCTTCGAGGAC NM_033400 No/No NA P2RP3 bacterial: kanamycin
25 HsUT00697968 Plasmid Details 3'UTR MYO3B myosin IIIB Sequence Verified: Yes; 3'UTR length: 2223; Forward Primer: TCAAAAGGAGACTCTTTTGCTCAACATTAA; Reverse Primer: ACTGTGACTAGCCCAAGAATAATGTCTACA NM_001083615 No/No NA P2RP3 bacterial: kanamycin
26 HsUT00697969 Plasmid Details 3'UTR RKHD2 mex-3 RNA binding family member C Sequence Verified: Yes; 3'UTR length: 1981; Forward Primer: GTTACTCAGGCAATCCAAATTCACTCTTAA; Reverse Primer: AACCAAGAGCACACACACACAAAATAACTA NM_016626 No/No NA P2RP3 bacterial: kanamycin
27 HsUT00697970 Plasmid Details 3'UTR NR4A2 nuclear receptor subfamily 4, group A, member 2 Sequence Verified: Yes; 3'UTR length: 1492; Forward Primer: AAACTTTTCCTGGACACTTTACCTTTCTAA; Reverse Primer: TTCTGGTTCACCTGATTTCTTTTGCCA NM_006186 No/No NA P2RP3 bacterial: kanamycin
28 HsUT00697971 Plasmid Details 3'UTR DLX2 distal-less homeobox 2 Sequence Verified: Yes; 3'UTR length: 1285; Forward Primer: GCGGGGACGATTTTCTAA; Reverse Primer: GCCTGTCCTCTCCTTGCC NM_004405 No/No NA P2RP3 bacterial: kanamycin
29 HsUT00697972 Plasmid Details 3'UTR NFRKB nuclear factor related to kappaB binding protein Sequence Verified: Yes; 3'UTR length: 1130; Forward Primer: CAGGCACCTGAGCAACAATGA; Reverse Primer: AACAAACAAACAAACAAACAAAAAACGCTT NM_001143835 No/No NA P2RP3 bacterial: kanamycin
30 HsUT00697973 Plasmid Details 3'UTR ZNF75A zinc finger protein 75a Sequence Verified: Yes; 3'UTR length: 887; Forward Primer: AGACACCAGAAACTCCACCTGTGA; Reverse Primer: CTCTCATTCTTAACAACAAAGAAAAGCCAA NM_153028 No/No NA P2RP3 bacterial: kanamycin
31 HsUT00697974 Plasmid Details 3'UTR MCM3 minichromosome maintenance complex component 3 Sequence Verified: Yes; 3'UTR length: 754; Forward Primer: GGCATCATCTTCCTCATCTGA; Reverse Primer: CTCTAGAGAAGACATGACCCCCAGA NM_002388 No/No NA P2RP3 bacterial: kanamycin
32 HsUT00697975 Plasmid Details 3'UTR HBP1 HMG-box transcription factor 1 Sequence Verified: Yes; 3'UTR length: 1278; Forward Primer: TTATTTCCACAGGGCTCACAACAACATTAA; Reverse Primer: TAATTTTTAAAATCCTATCAGCAGCCTCCT NM_012257 No/No NA P2RP3 bacterial: kanamycin
33 HsUT00697976 Plasmid Details 3'UTR PKNOX2 PBX/knotted 1 homeobox 2 Sequence Verified: Yes; 3'UTR length: 2177; Forward Primer: CACAGTGACTCCCTGGAGTAG; Reverse Primer: CTGAGCTCACGCAGGACG NM_022062 No/No NA P2RP3 bacterial: kanamycin
34 HsUT00697977 Plasmid Details 3'UTR HNRPA0 heterogeneous nuclear ribonucleoprotein A0 Sequence Verified: Yes; 3'UTR length: 1945; Forward Primer: TATGGAGGCAGCTCCTTCTAA; Reverse Primer: CAAAATGACTACTGAGCAGCTATAACCTAG NM_006805 No/No NA P2RP3 bacterial: kanamycin
35 HsUT00697978 Plasmid Details 3'UTR HOXC13 homeobox C13 Sequence Verified: Yes; 3'UTR length: 1468; Forward Primer: CATCTCCACTCCACCTGA; Reverse Primer: AGTGGAGCAAAACAAGGGTTTGGAA NM_017410 No/No NA P2RP3 bacterial: kanamycin
36 HsUT00697979 Plasmid Details 3'UTR ZNF563 zinc finger protein 563 Sequence Verified: Yes; 3'UTR length: 1284; Forward Primer: GAAAAGACTCACTGGAGAGAAACAATATGA; Reverse Primer: GACAGGGTTTTGCCACATTACCCA NM_145276 No/No NA P2RP3 bacterial: kanamycin
37 HsUT00697980 Plasmid Details 3'UTR TRIO trio Rho guanine nucleotide exchange factor Sequence Verified: Yes; 3'UTR length: 1107; Forward Primer: AGGCTTCTGCCTAGAGTTTGA; Reverse Primer: TCAGAGTATGAAATCACTTTTACAGTCCTC NM_007118 No/No NA P2RP3 bacterial: kanamycin
38 HsUT00697981 Plasmid Details 3'UTR MBD1 methyl-CpG binding domain protein 1 Sequence Verified: Yes; 3'UTR length: 886; Forward Primer: TCCGTCCTGGTTCCCTGA; Reverse Primer: AAAGCTCTAATTACAATTCCAGTTGACTTT NM_001204141 No/No NA P2RP3 bacterial: kanamycin
39 HsUT00697982 Plasmid Details 3'UTR DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 Sequence Verified: Yes; 3'UTR length: 745; Forward Primer: ACAATTGTGAAACTTGTCACCACACAATAA; Reverse Primer: GATTCGTGTCTGGGTGAGTTGATAAGA NM_198963 No/No NA P2RP3 bacterial: kanamycin
40 HsUT00697983 Plasmid Details 3'UTR NONO non-POU domain containing, octamer-binding Sequence Verified: Yes; 3'UTR length: 1272; Forward Primer: AACAAACGTCGCCGATACTAA; Reverse Primer: TTGATGCACCTCATCCCCAC NM_001145410 No/No NA P2RP3 bacterial: kanamycin
41 HsUT00697984 Plasmid Details 3'UTR SOX7 SRY (sex determining region Y)-box 7 Sequence Verified: Yes; 3'UTR length: 2150; Forward Primer: ACGTACTACAACAGCTACAGTGTGTCATAG; Reverse Primer: AACCATCCCTACCAGATAACAACTTTTTAA NM_031439 No/No NA P2RP3 bacterial: kanamycin
42 HsUT00697985 Plasmid Details 3'UTR ZC3H14 zinc finger CCCH-type containing 14 Sequence Verified: Yes; 3'UTR length: 1938; Forward Primer: AATTTTTGGTTCTGTTCATTCAGCGAATAG; Reverse Primer: TTGTGGTCCCTTTTTGTGGTGATCATTTTA NM_001160103 No/No NA P2RP3 bacterial: kanamycin
43 HsUT00697986 Plasmid Details 3'UTR TFAP2C transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) Sequence Verified: Yes; 3'UTR length: 1449; Forward Primer: CTGGAGAAAATGGAGAAACACAGGAAATAA; Reverse Primer: AAACTTCAGGTTCCTCCCCAACA NM_003222 No/No NA P2RP3 bacterial: kanamycin
44 HsUT00697987 Plasmid Details 3'UTR ZNF19 zinc finger protein 19 Sequence Verified: Yes; 3'UTR length: 1277; Forward Primer: CCAGAATTTTTTACCCCCTTTTACTGGTAA; Reverse Primer: AAGGTGTTTACTCAATTCCCCAAGTCTATC NM_006961 No/No NA P2RP3 bacterial: kanamycin
45 HsUT00697988 Plasmid Details 3'UTR REXO4 REX4, RNA exonuclease 4 homolog (S. cerevisiae) Sequence Verified: Yes; 3'UTR length: 1071; Forward Primer: TGCAGTGACGACGCCTAG; Reverse Primer: GCCAGTTTCTGCCTTAATCATTTCTG NM_020385 No/No NA P2RP3 bacterial: kanamycin
46 HsUT00697989 Plasmid Details 3'UTR SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa Sequence Verified: Yes; 3'UTR length: 744; Forward Primer: CGTGGAAACATCTTTCAAAAGCGAAGATAA; Reverse Primer: CCTCCTGGGTTCAAGCGAATCTT NM_004175 No/No NA P2RP3 bacterial: kanamycin
47 HsUT00697990 Plasmid Details 3'UTR ZNF26 zinc finger protein 26 Sequence Verified: Yes; 3'UTR length: 1267; Forward Primer: CTTCGTATACATCGGAAGACTCATAAATGA; Reverse Primer: TGGGAGGCTGAGGCAAGGA NM_001256280 No/No NA P2RP3 bacterial: kanamycin
48 HsUT00697991 Plasmid Details 3'UTR TAF1 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa Sequence Verified: Yes; 3'UTR length: 2139; Forward Primer: AGTGACTTGGACTCTGATGAATGA; Reverse Primer: TCCTTCTCTACCCACAAATGCCAA NM_138923 No/No NA P2RP3 bacterial: kanamycin
49 HsUT00697992 Plasmid Details 3'UTR UBE2B ubiquitin-conjugating enzyme E2B Sequence Verified: Yes; 3'UTR length: 1935; Forward Primer: ATTGTTGAACAAAGCTGGAATGATTCATAA; Reverse Primer: TTTAAACTGGGAAAGGCAAAAACAGGTC NM_003337 No/No NA P2RP3 bacterial: kanamycin
50 HsUT00697993 Plasmid Details 3'UTR ZNF136 zinc finger protein 136 Sequence Verified: Yes; 3'UTR length: 1428; Forward Primer: CCTTATAAATGCATGTGGGAAAGCCTTTAA; Reverse Primer: TGGGCAACAGAGCACAGAG NM_003437 No/No NA P2RP3 bacterial: kanamycin
51 HsUT00697994 Plasmid Details 3'UTR ZNF564 zinc finger protein 564 Sequence Verified: Yes; 3'UTR length: 1256; Forward Primer: CAACCTTCGAATACCTGTGAAAATGAATAG; Reverse Primer: GGGGTTTCATCATGTTAGCCAGGAT NM_144976 No/No NA P2RP3 bacterial: kanamycin
52 HsUT00697995 Plasmid Details 3'UTR RBPSUHL recombination signal binding protein for immunoglobulin kappa J region-like Sequence Verified: Yes; 3'UTR length: 1045; Forward Primer: TTCCACCTCTTCATCCAGACTTAG; Reverse Primer: CCTCCTCTAGAAAACGTCCAAAAGGTA NM_014276 No/No NA P2RP3 bacterial: kanamycin
53 HsUT00697996 Plasmid Details 3'UTR MAP3K15 mitogen-activated protein kinase kinase kinase 15 Sequence Verified: Yes; 3'UTR length: 871; Forward Primer: GAAACCAAAGACAAGGCTTGA; Reverse Primer: AAGAACAATTCCTTGTATGCCTGTTTCC NM_001001671 No/No NA P2RP3 bacterial: kanamycin
54 HsUT00697997 Plasmid Details 3'UTR PHC2 polyhomeotic homolog 2 (Drosophila) Sequence Verified: Yes; 3'UTR length: 1422; Forward Primer: AGCATGCTCAAGGACTCCTAG; Reverse Primer: ACCCTCAAATGACCCAGCTC NM_198040 No/No NA P2RP3 bacterial: kanamycin
55 HsUT00697998 Plasmid Details 3'UTR ROR2 receptor tyrosine kinase-like orphan receptor 2 Sequence Verified: Yes; 3'UTR length: 1246; Forward Primer: GTCCAGCTGGAAGCTTGA; Reverse Primer: GGGATATCCCCATTAGCATGGG NM_004560 No/No NA P2RP3 bacterial: kanamycin
56 HsUT00697999 Plasmid Details 3'UTR TRIB1 tribbles pseudokinase 1 Sequence Verified: Yes; 3'UTR length: 2111; Forward Primer: GACAGTGACATTAGTTCCTTCTTCTGCTAA; Reverse Primer: ATGATCCTCATCATCTCTACTTTTCCACCT NM_025195 No/No NA P2RP3 bacterial: kanamycin
57 HsUT00698000 Plasmid Details 3'UTR MAK male germ cell-associated kinase Sequence Verified: Yes; 3'UTR length: 1909; Forward Primer: TATGGAGGCCACCGGTAG; Reverse Primer: ACCCACCTATGACTCCCAGAGTT NM_005906 No/No NA P2RP3 bacterial: kanamycin
58 HsUT00698001 Plasmid Details 3'UTR RAVER1 ribonucleoprotein, PTB-binding 1 Sequence Verified: Yes; 3'UTR length: 1421; Forward Primer: CTGAAGCGGAAGAGGATTTTCTAA; Reverse Primer: ATCAATGGAACATAAGCGCAGATGTTT NM_133452 No/No NA P2RP3 bacterial: kanamycin
59 HsUT00698002 Plasmid Details 3'UTR TYRO3 TYRO3 protein tyrosine kinase Sequence Verified: Yes; 3'UTR length: 1242; Forward Primer: CTGCCACACAGTAGCTGTTAG; Reverse Primer: AATCCCAGCTACTCTGGTGACTGA NM_006293 No/No NA P2RP3 bacterial: kanamycin
60 HsUT00698003 Plasmid Details 3'UTR HOXC10 homeobox C10 Sequence Verified: Yes; 3'UTR length: 1012; Forward Primer: GAACTGACCTCCAATTTTAATTTCACCTGA; Reverse Primer: TTATGGTCTCTCACTTACATTAAACCCG NM_017409 No/No NA P2RP3 bacterial: kanamycin
61 HsUT00698004 Plasmid Details 3'UTR ETV4 ets variant 4 Sequence Verified: Yes; 3'UTR length: 856; Forward Primer: AAGGGTGGCTACTCTTACTAG; Reverse Primer: GAAACAGTCAGGTGAACTGCCTTTTTT NM_001079675 No/No NA P2RP3 bacterial: kanamycin
62 HsUT00698005 Plasmid Details 3'UTR ZNF606 zinc finger protein 606 Sequence Verified: Yes; 3'UTR length: 1408; Forward Primer: AGAAATCACAGTGAAGAGAAACTGAATTGA; Reverse Primer: TTATCCTTGGGGTTGCAGGCA NM_025027 No/No NA P2RP3 bacterial: kanamycin
63 HsUT00698006 Plasmid Details 3'UTR BCDO2 beta-carotene oxygenase 2 Sequence Verified: Yes; 3'UTR length: 1232; Forward Primer: CATGGTACCTTCATACCCATCTGA; Reverse Primer: TAAAAAAGTGTGCCTCTAATCTAACTCAGC NM_001037290 No/No NA P2RP3 bacterial: kanamycin
64 HsUT00698007 Plasmid Details 3'UTR ZFP36L2 ZFP36 ring finger protein-like 2 Sequence Verified: Yes; 3'UTR length: 2097; Forward Primer: TCCATCTCCGACGACTGA; Reverse Primer: TGAGAGGACGCAGGCTCTTCT NM_006887 No/No NA P2RP3 bacterial: kanamycin
65 HsUT00698008 Plasmid Details 3'UTR CNOT4 CCR4-NOT transcription complex, subunit 4 Sequence Verified: Yes; 3'UTR length: 1904; Forward Primer: CACACTACTGTGGCCTGA; Reverse Primer: ACTAACCACTTGCTATGGCTTTGTAAGAAG NM_001008225 No/No NA P2RP3 bacterial: kanamycin
66 HsUT00698009 Plasmid Details 3'UTR SNRPE small nuclear ribonucleoprotein polypeptide E Sequence Verified: Yes; 3'UTR length: 1400; Forward Primer: ATTACTCTGCTACAAAGTGTCTCCAACTAG; Reverse Primer: CTGCAGGGAGGTCTTTGCTCT NM_003094 No/No NA P2RP3 bacterial: kanamycin
67 HsUT00698010 Plasmid Details 3'UTR NFKBIE nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Sequence Verified: Yes; 3'UTR length: 1233; Forward Primer: CTGCTGTGTACCGACTGA; Reverse Primer: AATGCTCTGCCCCCATCC NM_004556 No/No NA P2RP3 bacterial: kanamycin
68 HsUT00698011 Plasmid Details 3'UTR GMEB1 glucocorticoid modulatory element binding protein 1 Sequence Verified: Yes; 3'UTR length: 1010; Forward Primer: AATGTGGAGATTGTGGTCTTAGAGGATTAA; Reverse Primer: TGTACCTTCCACTTATTACCACCTTCTTCT NM_024482 No/No NA P2RP3 bacterial: kanamycin
69 HsUT00698012 Plasmid Details 3'UTR EOMES eomesodermin Sequence Verified: Yes; 3'UTR length: 855; Forward Primer: GGGTATTATGCTTTTTACACAACTCCCTAA; Reverse Primer: TTGCAAATTCTTTACAAAGCCAAAGCAC NM_005442 No/No NA P2RP3 bacterial: kanamycin
70 HsUT00698013 Plasmid Details 3'UTR SF1 splicing factor 1 Sequence Verified: Yes; 3'UTR length: 1394; Forward Primer: CCTCCACCACAGAACTAG; Reverse Primer: TAATTAACCACCCACAGTCTCACC NM_004630 No/No NA P2RP3 bacterial: kanamycin
71 HsUT00698014 Plasmid Details 3'UTR CDR2 cerebellar degeneration-related protein 2, 62kDa Sequence Verified: Yes; 3'UTR length: 1209; Forward Primer: AAATACCGATCACTCTCCTCTCATTCTTAA; Reverse Primer: AAGTTACACAAATCCAAGGATTCCCTGTTT NM_001802 No/No NA P2RP3 bacterial: kanamycin
72 HsUT00698015 Plasmid Details 3'UTR CHRAC1 chromatin accessibility complex 1 Sequence Verified: Yes; 3'UTR length: 2086; Forward Primer: GACCATGATGAAGCTGACTCCTAA; Reverse Primer: ATATAAAGGAATGGACTGCTGATACCTGTG NM_017444 No/No NA P2RP3 bacterial: kanamycin
73 HsUT00698016 Plasmid Details 3'UTR TIPARP TCDD-inducible poly(ADP-ribose) polymerase Sequence Verified: Yes; 3'UTR length: 1817; Forward Primer: GAAGAAGTCAGTAACACTGTTTCCATTTGA; Reverse Primer: CACACTGCAGAAAAGTTTAAGCAGCAA NM_015508 No/No NA P2RP3 bacterial: kanamycin
74 HsUT00698017 Plasmid Details 3'UTR TNRC9 TOX high mobility group box family member 3 Sequence Verified: Yes; 3'UTR length: 1399; Forward Primer: CAAGTATTATCGCAGGTCAGTATTTTCTGA; Reverse Primer: TCAAGGATCTTCATTTCAGGCTATGCAATG NM_001080430 No/No NA P2RP3 bacterial: kanamycin
75 HsUT00698018 Plasmid Details 3'UTR PRKG2 protein kinase, cGMP-dependent, type II Sequence Verified: Yes; 3'UTR length: 1205; Forward Primer: TCAGGCTGGGATAAAGACTTCTGA; Reverse Primer: TCCTACTTATTATTTGGGAGAGTGCAAGGA NM_006259 No/No NA P2RP3 bacterial: kanamycin
76 HsUT00698019 Plasmid Details 3'UTR DKC1 dyskeratosis congenita 1, dyskerin Sequence Verified: Yes; 3'UTR length: 1002; Forward Primer: GCAAAAGAGGTAGAATTGGTTTCTGAGTAG; Reverse Primer: CCCTCTCCTTCTCTGTTCTTCTAGAGAT NM_001363 No/No NA P2RP3 bacterial: kanamycin
77 HsUT00698020 Plasmid Details 3'UTR ZNF233 zinc finger protein 233 Sequence Verified: Yes; 3'UTR length: 824; Forward Primer: TTGTCTTCAGATTCATCAGAGAGTCCATGA; Reverse Primer: CCCGCCAAAGAAACATAGCACA NM_181756 No/No NA P2RP3 bacterial: kanamycin
78 HsUT00698021 Plasmid Details 3'UTR HOXA7 homeobox A7 Sequence Verified: Yes; 3'UTR length: 1370; Forward Primer: GAAGAGGAAGACGAGGAGGAATGA; Reverse Primer: TAAAAAGATACATGACACCAATACATGGGT NM_006896 No/No NA P2RP3 bacterial: kanamycin
79 HsUT00698022 Plasmid Details 3'UTR PNRC1 proline-rich nuclear receptor coactivator 1 Sequence Verified: Yes; 3'UTR length: 1144; Forward Primer: TTAAAAACGCTCCTCAAAGTTCAAACTTAG; Reverse Primer: CTTCTAAATGAGCTTCCCTTCCATTTGTGA NM_006813 No/No NA P2RP3 bacterial: kanamycin
80 HsUT00698024 Plasmid Details 3'UTR SUV39H1 suppressor of variegation 3-9 homolog 1 (Drosophila) Sequence Verified: Yes; 3'UTR length: 1625; Forward Primer: TGCCGCAAATACCTCTTCTAG; Reverse Primer: AGATGATGGTGTAAGTGATATGCTGTG NM_003173 No/No NA P2RP3 bacterial: kanamycin
81 HsUT00698025 Plasmid Details 3'UTR ZNF212 zinc finger protein 212 Sequence Verified: Yes; 3'UTR length: 1374; Forward Primer: CCCAATGGCCTGCTTTAA; Reverse Primer: CACATCTTGTCTTCTGTCCTAGGTTTAAGT NM_012256 No/No NA P2RP3 bacterial: kanamycin
82 HsUT00698026 Plasmid Details 3'UTR ZNF140 zinc finger protein 140 Sequence Verified: Yes; 3'UTR length: 1201; Forward Primer: TCATTCCTTACTGAACACCAGTGA; Reverse Primer: CTTACCTTCCTGATTAAGGCAAACTAACCC NM_003440 No/No NA P2RP3 bacterial: kanamycin
83 HsUT00698028 Plasmid Details 3'UTR CSRP3 cysteine and glycine-rich protein 3 (cardiac LIM protein) Sequence Verified: Yes; 3'UTR length: 820; Forward Primer: CTTACACAACAAGTGGAAAAGAAAGAATGA; Reverse Primer: TTGAGCTGCTGAAACTTGCTGAAGA NM_003476 No/No NA P2RP3 bacterial: kanamycin
84 HsUT00698029 Plasmid Details 3'UTR PNO1 partner of NOB1 homolog (S. cerevisiae) Sequence Verified: Yes; 3'UTR length: 1340; Forward Primer: AGCAGATCAGCAGATCGATTCTGA; Reverse Primer: AAGCATTCTTTCATCATTTCACCTTTACTA NM_020143 No/No NA P2RP3 bacterial: kanamycin
85 HsUT00698030 Plasmid Details 3'UTR ERN1 endoplasmic reticulum to nucleus signaling 1 Sequence Verified: Yes; 3'UTR length: 1138; Forward Primer: ACTCCAGACGCCCTCTGA; Reverse Primer: CTTCAAGTTTAGCTTACTTATGCTGACATA NM_001433 No/No NA P2RP3 bacterial: kanamycin
86 HsUT00698031 Plasmid Details 3'UTR CAMKK1 calcium/calmodulin-dependent protein kinase kinase 1, alpha Sequence Verified: Yes; 3'UTR length: 2068; Forward Primer: GACGAGGCTGCATCCTGA; Reverse Primer: CCCTCCGCCAAGACCACTT NM_032294 No/No NA P2RP3 bacterial: kanamycin
87 HsUT00698032 Plasmid Details 3'UTR MED4 mediator complex subunit 4 Sequence Verified: Yes; 3'UTR length: 1591; Forward Primer: AGCAGTAGTAGTGAGTCTGATTGA; Reverse Primer: TGAGCCAAGTTTGTGGTAATTTGTTACG NM_001270629 No/No NA P2RP3 bacterial: kanamycin
88 HsUT00698033 Plasmid Details 3'UTR ZNF195 zinc finger protein 195 Sequence Verified: Yes; 3'UTR length: 1371; Forward Primer: CTGACTGTACATGAAAGCATTCATACTTGA; Reverse Primer: GTCTCTAGCAGGTTCTGGAAGGG NM_001130520 No/No NA P2RP3 bacterial: kanamycin
89 HsUT00698034 Plasmid Details 3'UTR MAP2K3 mitogen-activated protein kinase kinase 3 Sequence Verified: Yes; 3'UTR length: 1189; Forward Primer: GAGATCCTGGGAGAAGACTCATAG; Reverse Primer: GATGTAGAAGGGCCTGGTAGGTT NM_002756 No/No NA P2RP3 bacterial: kanamycin
90 HsUT00698037 Plasmid Details 3'UTR LEF1 lymphoid enhancer-binding factor 1 Sequence Verified: Yes; 3'UTR length: 1307; Forward Primer: CTGGAGATGGAAGCTTGTTGA; Reverse Primer: ATTTACAGCCGGTTCTGGCCT NM_001130714 No/No NA P2RP3 bacterial: kanamycin
91 HsUT00698038 Plasmid Details 3'UTR PIAS3 protein inhibitor of activated STAT, 3 Sequence Verified: Yes; 3'UTR length: 1104; Forward Primer: GACATCATTTCCCTGGACTGA; Reverse Primer: CACAGAACACCCCCACCGT NM_006099 No/No NA P2RP3 bacterial: kanamycin
92 HsUT00698039 Plasmid Details 3'UTR ZNF569 zinc finger protein 569 Sequence Verified: Yes; 3'UTR length: 1619; Forward Primer: GTTAGACACCAGAGAATTCATACTCATTAG; Reverse Primer: AATCCATTTTAAAATTATTTCTCCAGGCCC NM_152484 No/No NA P2RP3 bacterial: kanamycin
93 HsUT00698040 Plasmid Details 3'UTR SOX30 SRY (sex determining region Y)-box 30 Sequence Verified: Yes; 3'UTR length: 1104; Forward Primer: CAAAACATGAGGGTATCTTTTCAACTTTAA; Reverse Primer: TGTTTAAGTCTCGTGTGAGCTAATAGAATC NM_007017 No/No NA P2RP3 bacterial: kanamycin
94 HsUT00698041 Plasmid Details 3'UTR ALDH1A1 aldehyde dehydrogenase 1 family, member A1 Sequence Verified: Yes; 3'UTR length: 726; Forward Primer: ACAGTGAAAATCTCTCAGAAGAACTCATAA; Reverse Primer: TTGGAAAATACAGCATGTTTCTTTACCTAT NM_000689 No/No NA P2RP3 bacterial: kanamycin
95 HsUT00698042 Plasmid Details 3'UTR TOE1 target of EGR1, member 1 (nuclear) Sequence Verified: Yes; 3'UTR length: 456; Forward Primer: ACTTGGGGCAGTAGCTGA; Reverse Primer: GCTTCTATGTATTTATCAACATGTGATACA NM_025077 No/No NA P2RP3 bacterial: kanamycin
96 HsUT00698043 Plasmid Details 3'UTR EIF2AK3 eukaryotic translation initiation factor 2-alpha kinase 3 Sequence Verified: Yes; 3'UTR length: 1175; Forward Primer: AGCCCTTTGCCAAGCAATTAG; Reverse Primer: GAAATGATGAAAAAGATACCTGTCTGAAAT NM_004836 No/No NA P2RP3 bacterial: kanamycin
97 HsUT00698044 Plasmid Details 3'UTR ZNF350 zinc finger protein 350 Sequence Verified: Yes; 3'UTR length: 694; Forward Primer: GTCTTATTTTATGTTACAGAAAACCCATAG; Reverse Primer: CATTTCACCTAATGTAGATATTTGCACCGC NM_021632 No/No NA P2RP3 bacterial: kanamycin
98 HsUT00698045 Plasmid Details 3'UTR ARID4B AT rich interactive domain 4B (RBP1-like) Sequence Verified: Yes; 3'UTR length: 1810; Forward Primer: ATGTCAGTTGAGTGCAGGTGA; Reverse Primer: GATTAATGGACTTTTAATTTTCATAGGTAG NM_031371 No/No NA P2RP3 bacterial: kanamycin
99 HsUT00698046 Plasmid Details 3'UTR RBBP7 retinoblastoma binding protein 7 Sequence Verified: Yes; 3'UTR length: 563; Forward Primer: CTGGAGGGACAAGGATCTTAA; Reverse Primer: ATATGTATGATAAACTTAACAGCTTCTGTG NM_002893 No/No NA P2RP3 bacterial: kanamycin
100 HsUT00698047 Plasmid Details 3'UTR ZNFX1 zinc finger, NFX1-type containing 1 Sequence Verified: Yes; 3'UTR length: 1545; Forward Primer: GAGGAGATCCAGGGGATGATGTAG; Reverse Primer: TAAAAATGATTCATTCACCAGCTAAATAAA NM_021035 No/No NA P2RP3 bacterial: kanamycin
101 HsUT00698049 Plasmid Details 3'UTR ZNF214 zinc finger protein 214 Sequence Verified: Yes; 3'UTR length: 724; Forward Primer: CACAATAATCATAGAAGAGGAAACTTATAA; Reverse Primer: ATTATTAAGCGTGGAAAACCGGAAAGG NM_013249 No/No NA P2RP3 bacterial: kanamycin
102 HsUT00698050 Plasmid Details 3'UTR PIAS1 protein inhibitor of activated STAT, 1 Sequence Verified: Yes; 3'UTR length: 411; Forward Primer: ATCATACCAGACATTATTTCATTGGACTGA; Reverse Primer: TGTTATTGCAAATAAAATAATGCCATCGAA NM_016166 No/No NA P2RP3 bacterial: kanamycin
103 HsUT00698051 Plasmid Details 3'UTR DLX6 distal-less homeobox 6 Sequence Verified: Yes; 3'UTR length: 1173; Forward Primer: CAGAGACCACAGATGATGTGA; Reverse Primer: TGATGTTCATATATATACATATGACTTCCC NM_005222 No/No NA P2RP3 bacterial: kanamycin
104 HsUT00698052 Plasmid Details 3'UTR YEATS4 YEATS domain containing 4 Sequence Verified: Yes; 3'UTR length: 660; Forward Primer: GAAGAAGATGACCAAGCAAAAGACATATAA; Reverse Primer: AGATATAATCTTTACCATCAAAGAGCTTCT NM_006530 No/No NA P2RP3 bacterial: kanamycin
105 HsUT00698053 Plasmid Details 3'UTR CRY1 cryptochrome circadian clock 1 Sequence Verified: Yes; 3'UTR length: 1602; Forward Primer: CCTAAAGTCCAGAGACAGAGCACTAATTAG; Reverse Primer: TTTTGAAAAACACTGTTTAACTAAACATAT NM_004075 No/No NA P2RP3 bacterial: kanamycin
106 HsUT00698054 Plasmid Details 3'UTR RNF113B ring finger protein 113B Sequence Verified: Yes; 3'UTR length: 558; Forward Primer: TTTTTTGTTCTTTTAGGAAAAAAGAGATAA; Reverse Primer: TTTCATTTAGCAAAACTCAAGCTCTGTACC NM_178861 No/No NA P2RP3 bacterial: kanamycin
107 HsUT00698055 Plasmid Details 3'UTR NR2E1 nuclear receptor subfamily 2, group E, member 1 Sequence Verified: Yes; 3'UTR length: 1526; Forward Primer: TCAGATATGTACAAATCCAGTGATATCTAA; Reverse Primer: ACTGTAAGAAGGAAATTGCCTTTGTAGTTC NM_003269 No/No NA P2RP3 bacterial: kanamycin
108 HsUT00698056 Plasmid Details 3'UTR ZNF439 zinc finger protein 439 Sequence Verified: Yes; 3'UTR length: 1102; Forward Primer: AAGAATGCACTCTGGAGAAAGACCTTATAA; Reverse Primer: GCAAAAGGAAAAAAAAAGAAAAATTACAGT NM_152262 No/No NA P2RP3 bacterial: kanamycin
109 HsUT00698057 Plasmid Details 3'UTR REL v-rel avian reticuloendotheliosis viral oncogene homolog Sequence Verified: Yes; 3'UTR length: 688; Forward Primer: TCCTTTCCATATGAATTTTTTCAAGTATAA; Reverse Primer: TGGCCCATGGGCCTCAAAAATAAA NM_002908 No/No NA P2RP3 bacterial: kanamycin
110 HsUT00698058 Plasmid Details 3'UTR NMI N-myc (and STAT) interactor Sequence Verified: Yes; 3'UTR length: 405; Forward Primer: CAACCTCACATAGCATACTTTGAAGAATAG; Reverse Primer: GGAAAATGTTAAGAGTCAAGTCTGCATATT NM_004688 No/No NA P2RP3 bacterial: kanamycin
111 HsUT00698059 Plasmid Details 3'UTR RBM22 RNA binding motif protein 22 Sequence Verified: Yes; 3'UTR length: 1141; Forward Primer: AAACACAGCAGCCCCTAG; Reverse Primer: TAAATCATCACGGAATGGATATAATCAAAA NM_018047 No/No NA P2RP3 bacterial: kanamycin
112 HsUT00698060 Plasmid Details 3'UTR ZNF174 zinc finger protein 174 Sequence Verified: Yes; 3'UTR length: 625; Forward Primer: CTTCACCATGGGGACTAA; Reverse Primer: TTTTCTTTTTGTAAAAGCACCATCTAACTA NM_003450 No/No NA P2RP3 bacterial: kanamycin
113 HsUT00698061 Plasmid Details 3'UTR TROVE2 TROVE domain family, member 2 Sequence Verified: Yes; 3'UTR length: 1434; Forward Primer: ATTCGAAATTTCACATTAGATATGATTTAA; Reverse Primer: ACTACAGTTTGACTTTTCACATAACAGCGA NM_004600 No/No NA P2RP3 bacterial: kanamycin
114 HsUT00698062 Plasmid Details 3'UTR MELK maternal embryonic leucine zipper kinase Sequence Verified: Yes; 3'UTR length: 526; Forward Primer: GAAGACATCCTATCTAGCTGCAAGGTATAA; Reverse Primer: AAAATTATGCAAATGAATTCTTATCTGTTT NM_001256693 No/No NA P2RP3 bacterial: kanamycin
115 HsUT00698064 Plasmid Details 3'UTR ZNF143 zinc finger protein 143 Sequence Verified: Yes; 3'UTR length: 1091; Forward Primer: ACGCCAGGGTTGGATGATTAA; Reverse Primer: TAAAAATATATGGAAAAGCACTTACTCTGT NM_003442 No/No NA P2RP3 bacterial: kanamycin
116 HsUT00698065 Plasmid Details 3'UTR ZNF415 zinc finger protein 415 Sequence Verified: Yes; 3'UTR length: 678; Forward Primer: ACTAAGGAGAAACCTTATAAAAGAAATTAA; Reverse Primer: TCCCAGACATTGCCATGAAAGG NM_018355 No/No NA P2RP3 bacterial: kanamycin
117 HsUT00698067 Plasmid Details 3'UTR ZNF599 zinc finger protein 599 Sequence Verified: Yes; 3'UTR length: 1140; Forward Primer: CACCATCGAAAGATTCATACCAGAGTTTAA; Reverse Primer: TATAGTATAGGTGTTCACAGTACCATTTAC NM_001007248 No/No NA P2RP3 bacterial: kanamycin
118 HsUT00698068 Plasmid Details 3'UTR TDRD10 tudor domain containing 10 Sequence Verified: Yes; 3'UTR length: 617; Forward Primer: CACATCCTAAAGTTTGAAGAGTCTAAATAA; Reverse Primer: CCCTACACTTCAAACATGTATCTATATCCC NM_182499 No/No NA P2RP3 bacterial: kanamycin
119 HsUT00698069 Plasmid Details 3'UTR ZNF577 zinc finger protein 577 Sequence Verified: Yes; 3'UTR length: 1414; Forward Primer: TTGTATCTTACAGATATTGTATCAGAATAA; Reverse Primer: ACGCTGTAGTGCAGTGGCAT NM_001135590 No/No NA P2RP3 bacterial: kanamycin
120 HsUT00698070 Plasmid Details 3'UTR ZNF749 zinc finger protein 749 Sequence Verified: Yes; 3'UTR length: 518; Forward Primer: CAGATAATTCATACTGGAAAAAGGCCTTAG; Reverse Primer: TTAAGTTACCTGTAATTTGCCACAATTATA NM_001023561 No/No NA P2RP3 bacterial: kanamycin
121 HsUT00698071 Plasmid Details 3'UTR ZNF484 zinc finger protein 484 Sequence Verified: Yes; 3'UTR length: 1377; Forward Primer: CAAGGCCAACTTTCTTCTATCTAG; Reverse Primer: GTGGGTTAATTTAAATGGATATTGACTCAA NM_001261458 No/No NA P2RP3 bacterial: kanamycin
122 HsUT00698072 Plasmid Details 3'UTR ZFP64 ZFP64 zinc finger protein Sequence Verified: Yes; 3'UTR length: 1048; Forward Primer: GACTCCATTCCAGATTAG; Reverse Primer: TATTTAATGTGACTGTGGAGGAGGTAAGAT NM_199426 No/No NA P2RP3 bacterial: kanamycin
123 HsUT00698073 Plasmid Details 3'UTR PRKCB1 protein kinase C, beta Sequence Verified: Yes; 3'UTR length: 678; Forward Primer: ACTAACCCAGAGTTTGTCATTAATGTGTAG; Reverse Primer: AAGTATCTTATTTTGTCATGTTCACAATGG NM_212535 No/No NA P2RP3 bacterial: kanamycin
124 HsUT00698074 Plasmid Details 3'UTR NFATC1 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 Sequence Verified: Yes; 3'UTR length: 1973; Forward Primer: ACTTTCTCAATTTTTCTTTTCTTACAGTAA; Reverse Primer: CCCTTCCAACGGCGAATG NM_006162 No/No NA P2RP3 bacterial: kanamycin
125 HsUT00698075 Plasmid Details 3'UTR RAF1 Raf-1 proto-oncogene, serine/threonine kinase Sequence Verified: Yes; 3'UTR length: 1093; Forward Primer: AGGCTGCCTGTCTTCTAG; Reverse Primer: AAAGAGTACAAAGGTTAAATTACAAATTCA NM_002880 No/No NA P2RP3 bacterial: kanamycin
126 HsUT00698076 Plasmid Details 3'UTR ACTL6A actin-like 6A Sequence Verified: Yes; 3'UTR length: 575; Forward Primer: TGTGTAGAAAGAAAATGCCCTTGA; Reverse Primer: GAATTTGAATAATAGTTTTACCTCTGTTGT NM_178042 No/No NA P2RP3 bacterial: kanamycin
127 HsUT00698077 Plasmid Details 3'UTR ZNF85 zinc finger protein 85 Sequence Verified: Yes; 3'UTR length: 1322; Forward Primer: ACCCAGTCTGGAATGCAGTAG; Reverse Primer: ATTTATTATCAAAATAATGGTGCATAAAAC NM_001256172 No/No NA P2RP3 bacterial: kanamycin
128 HsUT00698079 Plasmid Details 3'UTR ZNF154 zinc finger protein 154 Sequence Verified: Yes; 3'UTR length: 1373; Forward Primer: ATTAAACATCAGAGAATTCATAGTCGATAA; Reverse Primer: CCTTGAGGTGAAAATCCCAGAGG NM_001085384 No/No NA P2RP3 bacterial: kanamycin
129 HsUT00698080 Plasmid Details 3'UTR SYNCRIP synaptotagmin binding, cytoplasmic RNA interacting protein Sequence Verified: Yes; 3'UTR length: 961; Forward Primer: ACTTTTGGGCAACAGTGGAAGTAG; Reverse Primer: ATCTGAGTTTTAGGTTAGTTAGGATAAACT NM_006372 No/No NA P2RP3 bacterial: kanamycin
130 HsUT00698081 Plasmid Details 3'UTR LHX4 LIM homeobox 4 Sequence Verified: Yes; 3'UTR length: 654; Forward Primer: CTCGATGAAATGGATCATCCTCCTTTTTAA; Reverse Primer: TCATATTCTCTGGTTTGTAGGAAAGAATTC NM_033343 No/No NA P2RP3 bacterial: kanamycin
131 HsUT00698083 Plasmid Details 3'UTR SOHLH2 spermatogenesis and oogenesis specific basic helix-loop-helix 2 Sequence Verified: Yes; 3'UTR length: 1006; Forward Primer: CAACAGTTTTGGGCGTATTAA; Reverse Primer: GTATCCTCAAAGAAAAGTTGTACAATTTGA NM_017826 No/No NA P2RP3 bacterial: kanamycin
132 HsUT00698084 Plasmid Details 3'UTR GSC goosecoid homeobox Sequence Verified: Yes; 3'UTR length: 448; Forward Primer: TTGGACTCGGACAGCTGA; Reverse Primer: ATTTCTTGTTTGTTTGTTTGTTTAGGTAGA NM_173849 No/No NA P2RP3 bacterial: kanamycin
133 HsUT00698085 Plasmid Details 3'UTR ZNF676 zinc finger protein 676 Sequence Verified: Yes; 3'UTR length: 1029; Forward Primer: AAGAAAATTCATACTGGAGAGAATCCCTAA; Reverse Primer: CTTTATTTAATATGAACTCTCTGGTGTTGA NM_001001411 No/No NA P2RP3 bacterial: kanamycin
134 HsUT00698086 Plasmid Details 3'UTR SATB1 SATB homeobox 1 Sequence Verified: Yes; 3'UTR length: 1709; Forward Primer: ACAGACATTAATACTGATTTGAAAGACTGA; Reverse Primer: TGAAAAAAAAAAGCTAAGGGGTTTTTATAC NM_001131010 No/No NA P2RP3 bacterial: kanamycin
135 HsUT00698087 Plasmid Details 3'UTR DMTF1 cyclin D binding myb-like transcription factor 1 Sequence Verified: Yes; 3'UTR length: 1372; Forward Primer: GATGTCGAAGATTTGGTAAACTGTCATTAG; Reverse Primer: GACATATCCTAGATCACTTTGCTTTTTCTT NM_021145 No/No NA P2RP3 bacterial: kanamycin
136 HsUT00698088 Plasmid Details 3'UTR ZNF281 zinc finger protein 281 Sequence Verified: Yes; 3'UTR length: 906; Forward Primer: ACCAGCCAGAGTTACAGGTAA; Reverse Primer: TCAGTTAATCATATAATTTCAACTTGAGTT NM_012482 No/No NA P2RP3 bacterial: kanamycin
137 HsUT00698089 Plasmid Details 3'UTR PAXIP1 PAX interacting (with transcription-activation domain) protein 1 Sequence Verified: Yes; 3'UTR length: 639; Forward Primer: CTCAACAAGCCTACATATAAGTTTAACTGA; Reverse Primer: ACAAAAAAAATGGCTGGCTTCTAGAAATTA NM_007349 No/No NA P2RP3 bacterial: kanamycin
138 HsUT00698090 Plasmid Details 3'UTR ZNF682 zinc finger protein 682 Sequence Verified: Yes; 3'UTR length: 1767; Forward Primer: TTTAATCACTGCTCAAACCTTACTACGTAA; Reverse Primer: TTAAAGTCACTAAGGATAAGAATCACTAGA NM_033196 No/No NA P2RP3 bacterial: kanamycin
139 HsUT00698091 Plasmid Details 3'UTR ZNF253 zinc finger protein 253 Sequence Verified: Yes; 3'UTR length: 917; Forward Primer: GTTCCTCCACTTTTAATTAGCATAAGATAA; Reverse Primer: TCTTTGTATTTGCACAATTTTTCTCAAGGA NM_021047 No/No NA P2RP3 bacterial: kanamycin
140 HsUT00698092 Plasmid Details 3'UTR ZSCAN5 zinc finger and SCAN domain containing 5A Sequence Verified: Yes; 3'UTR length: 445; Forward Primer: AAAACACATCCAGAAGCTACTTCTCAGTGA; Reverse Primer: CTGATACTAAAGAAAATTGTTTATCTGAAA NM_024303 No/No NA P2RP3 bacterial: kanamycin
141 HsUT00698093 Plasmid Details 3'UTR ZNF285A zinc finger protein 285 Sequence Verified: Yes; 3'UTR length: 1006; Forward Primer: AGACTACATGAGCAGAGAGAAACATTATAA; Reverse Primer: CTTGAAGATTTAAAAGTTTTGAACTCTGAA NM_152354 No/No NA P2RP3 bacterial: kanamycin
142 HsUT00698094 Plasmid Details 3'UTR CHD3 chromodomain helicase DNA binding protein 3 Sequence Verified: Yes; 3'UTR length: 1352; Forward Primer: GTGATCTGTATAGACGACTGA; Reverse Primer: AACCTCAGTTTTAGTGAATAATCTAAGAGA NM_001005271 No/No NA P2RP3 bacterial: kanamycin
143 HsUT00698096 Plasmid Details 3'UTR TBX22 T-box 22 Sequence Verified: Yes; 3'UTR length: 838; Forward Primer: TGGTATCCAGCAATTAACCATTACCTTTAG; Reverse Primer: ATTCAAATGTATTCTCCCTCTTGTAATCAT NM_001109879 No/No NA P2RP3 bacterial: kanamycin
144 HsUT00698097 Plasmid Details 3'UTR ANKHD1 ankyrin repeat and KH domain containing 1 Sequence Verified: Yes; 3'UTR length: 618; Forward Primer: GGAAACATGCATCTCAAATATGTCAACTAA; Reverse Primer: TAGTCTTAAAAGTGCTTTTTTAAGGCAGTC NM_017747 No/No NA P2RP3 bacterial: kanamycin
145 HsUT00698099 Plasmid Details 3'UTR ZNF251 zinc finger protein 251 Sequence Verified: Yes; 3'UTR length: 915; Forward Primer: AAGAAGATTTTCCAAGAAAGACATTTTTAA; Reverse Primer: AGAAAACAAACCAGTGGTTTCCAC NM_138367 No/No NA P2RP3 bacterial: kanamycin
146 HsUT00698100 Plasmid Details 3'UTR POU1F1 POU class 1 homeobox 1 Sequence Verified: Yes; 3'UTR length: 441; Forward Primer: ATTTCTAAGGAACATCTTGAGTGCAGATAA; Reverse Primer: GTTAATTTTTGAATTGGATATTTCTGGTGA NM_001122757 No/No NA P2RP3 bacterial: kanamycin
147 HsUT00698102 Plasmid Details 3'UTR TTRAP tyrosyl-DNA phosphodiesterase 2 Sequence Verified: Yes; 3'UTR length: 991; Forward Primer: CTTCTGTGCAACTTAGATATAATATTGTAA; Reverse Primer: TATATTCTTGGTAATTCTTGGTGGAGTGAG NM_016614 No/No NA P2RP3 bacterial: kanamycin
148 HsUT00698103 Plasmid Details 3'UTR PARN poly(A)-specific ribonuclease Sequence Verified: Yes; 3'UTR length: 1197; Forward Primer: TTTGAAGTTCCTGACACATGGTAA; Reverse Primer: CAGTTAGGGGTAAAAAGAAGAAGAAAAAAA NM_002582 No/No NA P2RP3 bacterial: kanamycin
149 HsUT00698104 Plasmid Details 3'UTR CDKL4 cyclin-dependent kinase-like 4 Sequence Verified: Yes; 3'UTR length: 799; Forward Primer: CAGGTACTTCCGCTCAAAAGTTAA; Reverse Primer: ATTACCAACTCAGTTTATTATTAGGCAATG NM_001009565 No/No NA P2RP3 bacterial: kanamycin
150 HsUT00698105 Plasmid Details 3'UTR ATF7 activating transcription factor 7 Sequence Verified: Yes; 3'UTR length: 535; Forward Primer: TGCTTTGGGATAATTTTCTTAATTGGTTAA; Reverse Primer: AAAAGTTCCCGAAGTGACATAGTTTATAGT NM_001206683 No/No NA P2RP3 bacterial: kanamycin
151 HsUT00698106 Plasmid Details 3'UTR LRRK2 leucine-rich repeat kinase 2 Sequence Verified: Yes; 3'UTR length: 1699; Forward Primer: GAAAAAATGAGACGAACATCTGTTGAGTAA; Reverse Primer: AAGGAAAAAACTTTAGTTGCACTTTCTTAT NM_198578 No/No NA P2RP3 bacterial: kanamycin
152 HsUT00698107 Plasmid Details 3'UTR CREB3L1 cAMP responsive element binding protein 3-like 1 Sequence Verified: Yes; 3'UTR length: 856; Forward Primer: ACCACCATCAAACTCTCCTAG; Reverse Primer: CTACCTCTACAAAAAAAAAAAAATGCCTTC NM_052854 No/No NA P2RP3 bacterial: kanamycin
153 HsUT00698109 Plasmid Details 3'UTR NEUROG1 neurogenin 1 Sequence Verified: Yes; 3'UTR length: 875; Forward Primer: TGTTTCATTCCTTACCACTAG; Reverse Primer: AATCAGGTGCGTTTTATTTTTTAATTGTTT NM_006161 No/No NA P2RP3 bacterial: kanamycin
154 HsUT00698110 Plasmid Details 3'UTR ZNF410 zinc finger protein 410 Sequence Verified: Yes; 3'UTR length: 959; Forward Primer: GATTTGCTTTCAATCTTTTACAGTTACTAA; Reverse Primer: GCTTAAGAAATGAAGATGTTCTTGTTGTTT NM_001242928 No/No NA P2RP3 bacterial: kanamycin
155 HsUT00698111 Plasmid Details 3'UTR CNOT1 CCR4-NOT transcription complex, subunit 1 Sequence Verified: Yes; 3'UTR length: 1192; Forward Primer: GGGACAGGTGCCAGTTAG; Reverse Primer: AGTAGGAATGACCTATCAATCAATCAATCA NM_016284 No/No NA P2RP3 bacterial: kanamycin
156 HsUT00698112 Plasmid Details 3'UTR TBP TATA box binding protein Sequence Verified: Yes; 3'UTR length: 785; Forward Primer: ATTCTAAAGGGATTCAGGAAGACGACGTAA; Reverse Primer: AATATATGGAAGGTTCTCAGATCATTAATC NM_001172085 No/No NA P2RP3 bacterial: kanamycin
157 HsUT00698113 Plasmid Details 3'UTR RAN RAN, member RAS oncogene family Sequence Verified: Yes; 3'UTR length: 535; Forward Primer: GATGAGGATGATGACCTGTGA; Reverse Primer: TGTACAAAAATAAACATAGGGAGAAATTAA NM_006325 No/No NA P2RP3 bacterial: kanamycin
158 HsUT00698114 Plasmid Details 3'UTR WDR77 WD repeat domain 77 Sequence Verified: Yes; 3'UTR length: 1520; Forward Primer: CCTGCAAGTGTTACTGAGTAG; Reverse Primer: TTACTTTCTCTAAGTGTCCACAAAATTAAA NM_024102 No/No NA P2RP3 bacterial: kanamycin
159 HsUT00698115 Plasmid Details 3'UTR CASP8AP2 caspase 8 associated protein 2 Sequence Verified: Yes; 3'UTR length: 807; Forward Primer: AACTTTAGCATTTTCTTACATTACAGATAA; Reverse Primer: CTCAATCTACTCAGAACCATTCAGCCA NM_012115 No/No NA P2RP3 bacterial: kanamycin
160 HsUT00698117 Plasmid Details 3'UTR BRF2 BRF2, RNA polymerase III transcription initiation factor 50 kDa subunit Sequence Verified: Yes; 3'UTR length: 790; Forward Primer: GTCCCTAACCCTCCCTGA; Reverse Primer: AGACATATTAGAAGAAAAAAAAAAGCTTTG NM_018310 No/No NA P2RP3 bacterial: kanamycin
161 HsUT00698118 Plasmid Details 3'UTR TBK1 TANK-binding kinase 1 Sequence Verified: Yes; 3'UTR length: 918; Forward Primer: CGCAACGTTGACTGTCTTTAG; Reverse Primer: AACTTCATACTAAATTTAGAATTAGTGGGT NM_013254 No/No NA P2RP3 bacterial: kanamycin
162 HsUT00698119 Plasmid Details 3'UTR HNRPLL heterogeneous nuclear ribonucleoprotein L-like Sequence Verified: Yes; 3'UTR length: 1176; Forward Primer: CTTTGCTTTTCTACATCATCCCATTTATAA; Reverse Primer: AAACAAAATGGCCACATCAGTTTTTCTATT NM_001142650 No/No NA P2RP3 bacterial: kanamycin
163 HsUT00698120 Plasmid Details 3'UTR NSUN6 NOP2/Sun domain family, member 6 Sequence Verified: Yes; 3'UTR length: 778; Forward Primer: GCAAAATTTGTAAAATGCAAAAGCACATAG; Reverse Primer: TCTTTCTCACCAAGCATTTTCTAATAACTG NM_182543 No/No NA P2RP3 bacterial: kanamycin
164 HsUT00698121 Plasmid Details 3'UTR AOF2 lysine (K)-specific demethylase 1A Sequence Verified: Yes; 3'UTR length: 507; Forward Primer: CAGTCCCCAAGCATGTGA; Reverse Primer: ACCATTTTTCTCTTTTATATGAACATCTTC NM_015013 No/No NA P2RP3 bacterial: kanamycin
165 HsUT00698122 Plasmid Details 3'UTR MEIS2 Meis homeobox 2 Sequence Verified: Yes; 3'UTR length: 1332; Forward Primer: GTTATGGACATTCATGCCCAATAG; Reverse Primer: AATAGACATTGAAAGGCTATAGATGATTAC NM_170676 No/No NA P2RP3 bacterial: kanamycin
166 HsUT00698123 Plasmid Details 3'UTR PLK2 polo-like kinase 2 Sequence Verified: Yes; 3'UTR length: 780; Forward Primer: CTGAACATGCTCTTACAAAGATGTAACTGA; Reverse Primer: GACTTCCTAGAAACTGTAGTTAGAAAAAAT NM_001252226 No/No NA P2RP3 bacterial: kanamycin
167 HsUT00698125 Plasmid Details 3'UTR ZNF44 zinc finger protein 44 Sequence Verified: Yes; 3'UTR length: 777; Forward Primer: AAAAGGACACACTGGAAGGATATTCTATAA; Reverse Primer: ACAAAAGTAATCTGAGTATTGAAACAAGAA NM_016264 No/No NA P2RP3 bacterial: kanamycin
168 HsUT00698126 Plasmid Details 3'UTR DKFZp762E1312 Holliday junction recognition protein Sequence Verified: Yes; 3'UTR length: 917; Forward Primer: CTAGAAAAATTGGAAACTAAAAGTGTGTAG; Reverse Primer: ACCCAAACTCATATGGCCATATATTAACTA NM_018410 No/No NA P2RP3 bacterial: kanamycin
169 HsUT00698127 Plasmid Details 3'UTR RALYL RALY RNA binding protein-like Sequence Verified: Yes; 3'UTR length: 1112; Forward Primer: TTATTTTCTCAGTTTCTACAGATAAAGTGA; Reverse Primer: GAGTGTGGGCATGTAGAACCTATGAT NM_001100392 No/No NA P2RP3 bacterial: kanamycin
170 HsUT00698128 Plasmid Details 3'UTR HTATIP2 HIV-1 Tat interactive protein 2, 30kDa Sequence Verified: Yes; 3'UTR length: 758; Forward Primer: GGCTCTCTCAAGCCATGA; Reverse Primer: TTTATAAGAGGGTTAAAGCACAGATAACAC NM_006410 No/No NA P2RP3 bacterial: kanamycin
171 HsUT00698129 Plasmid Details 3'UTR CLK1 CDC-like kinase 1 Sequence Verified: Yes; 3'UTR length: 477; Forward Primer: TTCTTTGACCTTCTGAAGAAAAGTATATAG; Reverse Primer: ACTCTTCTCGGCTAATCTTAAGTTCTGTGT NM_004071 No/No NA P2RP3 bacterial: kanamycin
172 HsUT00698130 Plasmid Details 3'UTR RBM7 RNA binding motif protein 7 Sequence Verified: Yes; 3'UTR length: 1286; Forward Primer: TGGCGCTCATCTCGACACTAA; Reverse Primer: CTATATGTACAAAAGATGTATTTCAGGATG NM_016090 No/No NA P2RP3 bacterial: kanamycin
173 HsUT00698131 Plasmid Details 3'UTR JMJD1A lysine (K)-specific demethylase 3A Sequence Verified: Yes; 3'UTR length: 777; Forward Primer: GAATCCAGTTTTGGCAAACCTTAA; Reverse Primer: TAGCTTTGTAATAATCACTAAGAAAATCAC NM_018433 No/No NA P2RP3 bacterial: kanamycin
174 HsUT00698133 Plasmid Details 3'UTR NR4A3 nuclear receptor subfamily 4, group A, member 3 Sequence Verified: Yes; 3'UTR length: 707; Forward Primer: TTATGGCTACTAGTAATAAGAGTTGATTGA; Reverse Primer: CAGACTGATGGGATTTTACTATATCCCATA NM_173199 No/No NA P2RP3 bacterial: kanamycin
175 HsUT00698134 Plasmid Details 3'UTR RSF1 remodeling and spacing factor 1 Sequence Verified: Yes; 3'UTR length: 868; Forward Primer: GATTATGTCTGTAACAGTGAACAGTTATAA; Reverse Primer: AAGAAAGACCACATTCATTTCACTAATAAC NM_016578 No/No NA P2RP3 bacterial: kanamycin
176 HsUT00698135 Plasmid Details 3'UTR ZNF184 zinc finger protein 184 Sequence Verified: Yes; 3'UTR length: 741; Forward Primer: AGACTGCATCCTGGCATATGA; Reverse Primer: TAAGATACCTAGTCTATTGTAATTTAACAT NM_007149 No/No NA P2RP3 bacterial: kanamycin
177 HsUT00698136 Plasmid Details 3'UTR ZNF732 zinc finger protein 732 Sequence Verified: Yes; 3'UTR length: 604; Forward Primer: AATAAAATTTATACTGGAGAGAAACTCTAG; Reverse Primer: TCTCTCCAGTATGAATCCTATGTTCAATTA NM_001137608 No/No NA P2RP3 bacterial: kanamycin
178 HsUT00698137 Plasmid Details 3'UTR ZBTB42 zinc finger and BTB domain containing 42 Sequence Verified: Yes; 3'UTR length: 2425; Forward Primer: GTCAAGTCCCTTCTGGTGTGA; Reverse Primer: CTCCCCCAAACGCTGGCA NM_001137601 No/No NA P2RP3 bacterial: kanamycin
179 HsUT00698139 Plasmid Details 3'UTR MBD3 methyl-CpG binding domain protein 3 Sequence Verified: Yes; 3'UTR length: 1841; Forward Primer: GAGATGGAGCACGTCTAG; Reverse Primer: CCTAAGCCTGACTCTTGGGTTGT NM_003926 No/No NA P2RP3 bacterial: kanamycin
180 HsUT00698140 Plasmid Details 3'UTR ZNF407 zinc finger protein 407 Sequence Verified: Yes; 3'UTR length: 1384; Forward Primer: GAACTCCAGGAAGCATGA; Reverse Primer: AGAAACAGTATCGGGCTGCAG NM_017757 No/No NA P2RP3 bacterial: kanamycin
181 HsUT00698141 Plasmid Details 3'UTR IKBKE inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon Sequence Verified: Yes; 3'UTR length: 925; Forward Primer: GCACCTCCTGATGTCTGA; Reverse Primer: TTTAGGGGAAAGGCAGAAATCAGGA NM_014002 No/No NA P2RP3 bacterial: kanamycin
182 HsUT00698142 Plasmid Details 3'UTR CARHSP1 calcium regulated heat stable protein 1, 24kDa Sequence Verified: Yes; 3'UTR length: 2399; Forward Primer: GGACATGTCATCAGCTCCTAG; Reverse Primer: AAACAGATGATCCCATCTTCTTATTCACCA NM_001042476 No/No NA P2RP3 bacterial: kanamycin
183 HsUT00698143 Plasmid Details 3'UTR ZNF307 zinc finger with KRAB and SCAN domains 4 Sequence Verified: Yes; 3'UTR length: 584; Forward Primer: CATGTAGGGAAAAAAACTCTTTCACAGTGA; Reverse Primer: GAGAATAATACATAAATTCAAATGGCATAA NM_019110 No/No NA P2RP3 bacterial: kanamycin
184 HsUT00698144 Plasmid Details 3'UTR ZNF571 zinc finger protein 571 Sequence Verified: Yes; 3'UTR length: 525; Forward Primer: CTTACTCAACATACAAGGCTTCATAATTGA; Reverse Primer: TCTAAAATAAAGTATCTGTTGTTCTAAAGG NM_016536 No/No NA P2RP3 bacterial: kanamycin
185 HsUT00698145 Plasmid Details 3'UTR BRD4 bromodomain containing 4 Sequence Verified: Yes; 3'UTR length: 2424; Forward Primer: CTCTACGTAGGTCCTGCCTAA; Reverse Primer: GCCTAAAGGGGCTGGTGGTA NM_014299 No/No NA P2RP3 bacterial: kanamycin
186 HsUT00698146 Plasmid Details 3'UTR SIX3 SIX homeobox 3 Sequence Verified: Yes; 3'UTR length: 1497; Forward Primer: GACTCGGAATGTGATGTATGA; Reverse Primer: CCTGTTCTGGTCTTCCCAATGC NM_005413 No/No NA P2RP3 bacterial: kanamycin
187 HsUT00698147 Plasmid Details 3'UTR TSHZ3 teashirt zinc finger homeobox 3 Sequence Verified: Yes; 3'UTR length: 1782; Forward Primer: CTGTATGTCTCTGAGTTAGAGAAGCAGTAG; Reverse Primer: AAACTCCCCCTGATTTACGCACA NM_020856 No/No NA P2RP3 bacterial: kanamycin
188 HsUT00698148 Plasmid Details 3'UTR TAOK3 TAO kinase 3 Sequence Verified: Yes; 3'UTR length: 1376; Forward Primer: TTAGATTTTCCTAAGGAGGACTACAGATGA; Reverse Primer: GAAGACAGAGCTTTACCTGAAAGGCTT NM_016281 No/No NA P2RP3 bacterial: kanamycin
189 HsUT00698149 Plasmid Details 3'UTR FOXF2 forkhead box F2 Sequence Verified: Yes; 3'UTR length: 918; Forward Primer: ATTAAGCCCTGCGTCATGTGA; Reverse Primer: TGTTACTCAAGGCACAGACCCC NM_001452 No/No NA P2RP3 bacterial: kanamycin
190 HsUT00698150 Plasmid Details 3'UTR TRAK1 trafficking protein, kinesin binding 1 Sequence Verified: Yes; 3'UTR length: 2333; Forward Primer: TCCAAACAAACTAGCTTACGGTGA; Reverse Primer: TTCATAAAGGTATGTATAATTCACAGCAGG NM_001042646 No/No NA P2RP3 bacterial: kanamycin
191 HsUT00698151 Plasmid Details 3'UTR PNPT1 polyribonucleotide nucleotidyltransferase 1 Sequence Verified: Yes; 3'UTR length: 2354; Forward Primer: ATTTCACAGTCATCATCTAATTCTCAGTGA; Reverse Primer: TGAAAAAGAAAACAGAAAATTTAAGAAAAA NM_033109 No/No NA P2RP3 bacterial: kanamycin
192 HsUT00698152 Plasmid Details 3'UTR LARP7 La ribonucleoprotein domain family, member 7 Sequence Verified: Yes; 3'UTR length: 445; Forward Primer: AAACATATAAGATTTTCTGAATATGATTGA; Reverse Primer: AACATGAAAAGGTATTGAAGGTATTGCAAG NM_015454 No/No NA P2RP3 bacterial: kanamycin
193 HsUT00698153 Plasmid Details 3'UTR ZNF468 zinc finger protein 468 Sequence Verified: Yes; 3'UTR length: 2373; Forward Primer: CATAGGCTTCATAGTGGAGAGAAGCCTTAA; Reverse Primer: ACCACAGCAGAAATAACCAATCAGG NM_199132 No/No NA P2RP3 bacterial: kanamycin
194 HsUT00698154 Plasmid Details 3'UTR JUP junction plakoglobin Sequence Verified: Yes; 3'UTR length: 1317; Forward Primer: GACCACATGCTGGCCTAG; Reverse Primer: CCCCCAACACTCCTGGCT NM_002230 No/No NA P2RP3 bacterial: kanamycin
195 HsUT00698155 Plasmid Details 3'UTR BNC1 basonuclin 1 Sequence Verified: Yes; 3'UTR length: 1719; Forward Primer: TCTCCAAGTCACCTCCAGTAA; Reverse Primer: TGTCCACCAAACTCTCCCCC NM_001717 No/No NA P2RP3 bacterial: kanamycin
196 HsUT00698156 Plasmid Details 3'UTR CRSP7 mediator complex subunit 26 Sequence Verified: Yes; 3'UTR length: 1300; Forward Primer: CCTTATGTCTGCTTGGACTGA; Reverse Primer: AGCAGGCTAACAGGTGGACT NM_004831 No/No NA P2RP3 bacterial: kanamycin
197 HsUT00698157 Plasmid Details 3'UTR BANP BTG3 associated nuclear protein Sequence Verified: Yes; 3'UTR length: 837; Forward Primer: GCCATCCAGATTCAGTGA; Reverse Primer: GGAAACAGAACTGACTGTCCCG NM_017869 No/No NA P2RP3 bacterial: kanamycin
198 HsUT00698158 Plasmid Details 3'UTR YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta Sequence Verified: Yes; 3'UTR length: 2262; Forward Primer: GGGGAGGGAGAGAACTAA; Reverse Primer: GGATAACACCTTGACTTCTGGTCCTAAATA NM_003404 No/No NA P2RP3 bacterial: kanamycin
199 HsUT00698160 Plasmid Details 3'UTR TSG101 tumor susceptibility 101 Sequence Verified: Yes; 3'UTR length: 415; Forward Primer: CTCAGTGACCTCTACTGA; Reverse Primer: TGGTATATCCCCATGTTAATTCACTTTATA NM_006292 No/No NA P2RP3 bacterial: kanamycin
200 HsUT00698161 Plasmid Details 3'UTR BAHD1 bromo adjacent homology domain containing 1 Sequence Verified: Yes; 3'UTR length: 2292; Forward Primer: ATCCTTAAGAACCCCCAGTAG; Reverse Primer: TTCCCTCACTCTCTTTTCCCTCTG NM_014952 No/No NA P2RP3 bacterial: kanamycin
201 HsUT00698162 Plasmid Details 3'UTR ZNF536 zinc finger protein 536 Sequence Verified: Yes; 3'UTR length: 1074; Forward Primer: AAATCTGCACATTTTCTTGCAGGTAAGTGA; Reverse Primer: AAAATGCAATGATCTGCCCCG NM_014717 No/No NA P2RP3 bacterial: kanamycin
202 HsUT00698163 Plasmid Details 3'UTR FGFR2 fibroblast growth factor receptor 2 Sequence Verified: Yes; 3'UTR length: 1707; Forward Primer: ATAAACGGCAGTGTTAAAACATGA; Reverse Primer: TGTCACAGGTACTGCTGGTCTCA NM_001144917 No/No NA P2RP3 bacterial: kanamycin
203 HsUT00698164 Plasmid Details 3'UTR TAF1C TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa Sequence Verified: Yes; 3'UTR length: 1274; Forward Primer: CCTCGAATGGGCTTCTGA; Reverse Primer: GGGAGAAAGCACAGGTCACC NM_001243158 No/No NA P2RP3 bacterial: kanamycin
204 HsUT00698165 Plasmid Details 3'UTR TBX1 T-box 1 Sequence Verified: Yes; 3'UTR length: 747; Forward Primer: CACTGCAAGGACACTTGA; Reverse Primer: CCCTACAGGGGAGGTCCCA NM_005992 No/No NA P2RP3 bacterial: kanamycin
205 HsUT00698166 Plasmid Details 3'UTR HOMEZ homeobox and leucine zipper encoding Sequence Verified: Yes; 3'UTR length: 2120; Forward Primer: GATGATGATGATGTGATCATACAAGACTGA; Reverse Primer: CACTTTTACAAGCTCTAGAATGGTGGAATG NM_020834 No/No NA P2RP3 bacterial: kanamycin
206 HsUT00698169 Plasmid Details 3'UTR UPF1 UPF1 regulator of nonsense transcripts homolog (yeast) Sequence Verified: Yes; 3'UTR length: 2247; Forward Primer: GGGCTGTCCCAGTATTAA; Reverse Primer: GGCAGGGGTCGCCCTTCA NM_002911 No/No NA P2RP3 bacterial: kanamycin
207 HsUT00698170 Plasmid Details 3'UTR MAP3K14 mitogen-activated protein kinase kinase kinase 14 Sequence Verified: Yes; 3'UTR length: 1695; Forward Primer: CTGGAGAACAGGCCCTAA; Reverse Primer: AGTGGTGGGAAAGCAGCC NM_003954 No/No NA P2RP3 bacterial: kanamycin
208 HsUT00698171 Plasmid Details 3'UTR APTX aprataxin Sequence Verified: Yes; 3'UTR length: 1258; Forward Primer: TTGGTATCTCATATTGGTTTTCCAGAGTAG; Reverse Primer: TCTCTCCAGAAGAAGCTTTTGTTAAGGG NM_175069 No/No NA P2RP3 bacterial: kanamycin
209 HsUT00698172 Plasmid Details 3'UTR ING1 inhibitor of growth family, member 1 Sequence Verified: Yes; 3'UTR length: 1322; Forward Primer: AAAGAGAGGGCTTACAACAGGTAG; Reverse Primer: ATGCTAGTCTAAATCAGAGGTCAGCAAA NM_001267728 No/No NA P2RP3 bacterial: kanamycin
210 HsUT00698173 Plasmid Details 3'UTR NFE2L1 nuclear factor, erythroid 2-like 1 Sequence Verified: Yes; 3'UTR length: 2084; Forward Primer: AAGGACCGGAGAAAGTGA; Reverse Primer: TATGAAGTACATGGTGTCTAATGCCTG NM_003204 No/No NA P2RP3 bacterial: kanamycin
211 HsUT00698174 Plasmid Details 3'UTR NCOA2 nuclear receptor coactivator 2 Sequence Verified: Yes; 3'UTR length: 1780; Forward Primer: TTATCTGTTTTCCTACAGAAATATTGCTGA; Reverse Primer: ATCAAAAAGATATCATTCTGAAATTTAGGT NM_006540 No/No NA P2RP3 bacterial: kanamycin
212 HsUT00698176 Plasmid Details 3'UTR ZNF229 zinc finger protein 229 Sequence Verified: Yes; 3'UTR length: 2232; Forward Primer: GTGCATTTAGGCGAGAACCCTTATAAGTAG; Reverse Primer: AAACACCGTGGCTCCTAATTATCTAGACTG NM_014518 No/No NA P2RP3 bacterial: kanamycin
213 HsUT00698177 Plasmid Details 3'UTR L3MBTL4 l(3)mbt-like 4 (Drosophila) Sequence Verified: Yes; 3'UTR length: 1694; Forward Primer: CAAGAAGTCAGGGGATGA; Reverse Primer: GAAATATATCCCAAGAAAGACAGCACTCCA NM_173464 No/No NA P2RP3 bacterial: kanamycin
214 HsUT00698178 Plasmid Details 3'UTR SGK1 serum/glucocorticoid regulated kinase 1 Sequence Verified: Yes; 3'UTR length: 1202; Forward Primer: ACGGACTCTTTCCTCTGA; Reverse Primer: ACCATCCTATACTCCCCTGGAGTC NM_001143676 No/No NA P2RP3 bacterial: kanamycin
215 HsUT00698179 Plasmid Details 3'UTR TADA1L transcriptional adaptor 1 Sequence Verified: Yes; 3'UTR length: 1235; Forward Primer: GGGCTTTTGCTGTGCTAA; Reverse Primer: AAATGGCATACCTTAGTTGGAATCTGCTTT NM_053053 No/No NA P2RP3 bacterial: kanamycin
216 HsUT00698180 Plasmid Details 3'UTR YTHDC2 YTH domain containing 2 Sequence Verified: Yes; 3'UTR length: 2084; Forward Primer: GGAGAAAAAAACACAACTGATTGA; Reverse Primer: TTACAGGGAAGGGAGTTTCAATACAAAC NM_022828 No/No NA P2RP3 bacterial: kanamycin
217 HsUT00698181 Plasmid Details 3'UTR ZNF677 zinc finger protein 677 Sequence Verified: Yes; 3'UTR length: 1767; Forward Primer: ACAAAAATTAAGTATTCAAGCTGTACCTAG; Reverse Primer: AAATTGTATACTGTTTGAACATAACATGGA NM_182609 No/No NA P2RP3 bacterial: kanamycin
218 HsUT00698182 Plasmid Details 3'UTR ZNF92 zinc finger protein 92 Sequence Verified: Yes; 3'UTR length: 1390; Forward Primer: AATTATACTAAAGAGAAACTACAAACCTGA; Reverse Primer: AAATAATATACTGTTACCATCTTTTACCCC NM_007139 No/No NA P2RP3 bacterial: kanamycin
219 HsUT00698183 Plasmid Details 3'UTR LSM5 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) Sequence Verified: Yes; 3'UTR length: 2108; Forward Primer: GGAGAAGGACCTGAAGTGTGA; Reverse Primer: ATTAGCCAAGGCAGTAGTACTGACAACA NM_001130710 No/No NA P2RP3 bacterial: kanamycin
220 HsUT00698184 Plasmid Details 3'UTR ZSCAN12 zinc finger and SCAN domain containing 12 Sequence Verified: Yes; 3'UTR length: 1684; Forward Primer: CACAAAGGAGAAAAATCTGTTTCTGTGTGA; Reverse Primer: TGGAGTTTGCTGTGGCAGG NM_001163391 No/No NA P2RP3 bacterial: kanamycin
221 HsUT00698186 Plasmid Details 3'UTR BASP1 brain abundant, membrane attached signal protein 1 Sequence Verified: Yes; 3'UTR length: 1125; Forward Primer: ACCGTAACCGTGAAAGAGTGA; Reverse Primer: ATTACAGGCGTGATCCACCGT NM_001271606 No/No NA P2RP3 bacterial: kanamycin
222 HsUT00698187 Plasmid Details 3'UTR RBM12B RNA binding motif protein 12B Sequence Verified: Yes; 3'UTR length: 2082; Forward Primer: CCCCGAAAAGTTAAGTTAACTTTGCTGTAG; Reverse Primer: CCAAATGAACCATCTATACAATCTTTGCTC NM_203390 No/No NA P2RP3 bacterial: kanamycin
223 HsUT00698188 Plasmid Details 3'UTR NPAT nuclear protein, ataxia-telangiectasia locus Sequence Verified: Yes; 3'UTR length: 1730; Forward Primer: TTTTTGTTATCATTGCATTATGATGAGTAA; Reverse Primer: TGAATTTTCAGTGCTTAGTACATACAACTA NM_002519 No/No NA P2RP3 bacterial: kanamycin
224 HsUT00698189 Plasmid Details 3'UTR ZNF69 zinc finger protein 69 Sequence Verified: Yes; 3'UTR length: 1320; Forward Primer: AATTTTTCTTATCTTTTTTTTTTTCCAGAA; Reverse Primer: CTTAAAGGAAGTGACTGAATTGTTCTAAGC NM_021915 No/No NA P2RP3 bacterial: kanamycin
225 HsUT00698190 Plasmid Details 3'UTR SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 Sequence Verified: Yes; 3'UTR length: 2017; Forward Primer: GTGCCACCTCCACAGTGA; Reverse Primer: GCCCTGTACTAGCCATCTGG NM_001130420 No/No NA P2RP3 bacterial: kanamycin
226 HsUT00698191 Plasmid Details 3'UTR DPPA5 developmental pluripotency associated 5 Sequence Verified: Yes; 3'UTR length: 438; Forward Primer: CTAGGCCCTTGGATGAAGTGA; Reverse Primer: CTCCACCCTTTTTGACACTAGCCAA NM_001025290 No/No NA P2RP3 bacterial: kanamycin
227 HsUT00698192 Plasmid Details 3'UTR LSM11 LSM11, U7 small nuclear RNA associated Sequence Verified: Yes; 3'UTR length: 1654; Forward Primer: CTGGTTCATCTTGCACAGTGA; Reverse Primer: GCTGAGATTACTTTTTTATGTAGCACCTGC NM_173491 No/No NA P2RP3 bacterial: kanamycin
228 HsUT00698193 Plasmid Details 3'UTR ZNF530 zinc finger protein 530 Sequence Verified: Yes; 3'UTR length: 1124; Forward Primer: CACAGAAGAGTTCATGTGCAGTGA; Reverse Primer: ATGGAGCAAAATCTATATTCTGTGAGCATA NM_020880 No/No NA P2RP3 bacterial: kanamycin
229 HsUT00698194 Plasmid Details 3'UTR HSPB8 heat shock 22kDa protein 8 Sequence Verified: Yes; 3'UTR length: 1068; Forward Primer: GAAGTCACCTGTACCTGA; Reverse Primer: TGCCTCGCCCAGCCTTTG NM_014365 No/No NA P2RP3 bacterial: kanamycin
230 HsUT00698195 Plasmid Details 3'UTR POU4F2 POU class 4 homeobox 2 Sequence Verified: Yes; 3'UTR length: 1843; Forward Primer: AAAAGAATGAAATATTCCGCCGGCATTTAG; Reverse Primer: ATACTTTACCATAGAAACAGCCCTTACTAA NM_004575 No/No NA P2RP3 bacterial: kanamycin
231 HsUT00698196 Plasmid Details 3'UTR THAP9 THAP domain containing 9 Sequence Verified: Yes; 3'UTR length: 1387; Forward Primer: CTAAGTAACGATGGATATCCATTCAAATGA; Reverse Primer: CAGACATTTGTATTTTAGTCAAATGTAACA NM_024672 No/No NA P2RP3 bacterial: kanamycin
232 HsUT00698197 Plasmid Details 3'UTR ELL elongation factor RNA polymerase II Sequence Verified: Yes; 3'UTR length: 2269; Forward Primer: CTGCAGGCTTGGCCCTAG; Reverse Primer: CACACAACATCCAACACACACCG NM_006532 No/No NA P2RP3 bacterial: kanamycin
233 HsUT00698198 Plasmid Details 3'UTR PTBP1 polypyrimidine tract binding protein 1 Sequence Verified: Yes; 3'UTR length: 1681; Forward Primer: TCCTTCTCCAAGTCCACCATCTAG; Reverse Primer: TTGGTCATTCGCTCTGGCC NM_002819 No/No NA P2RP3 bacterial: kanamycin
234 HsUT00698199 Plasmid Details 3'UTR FLJ46831 forkhead box I2 Sequence Verified: Yes; 3'UTR length: 2401; Forward Primer: GAAGGGACCGAAGTTTGA; Reverse Primer: GATTGTCCAATTGTCCATTGCATTTTCCAA NM_207426 No/No NA P2RP3 bacterial: kanamycin
235 HsUT00698200 Plasmid Details 3'UTR FOXF1 forkhead box F1 Sequence Verified: Yes; 3'UTR length: 1559; Forward Primer: ATCAAGCCTTGCGTGATGTGA; Reverse Primer: AAAAGAGGAGGATTTGCCAAAAAAGAAAAA NM_001451 No/No NA P2RP3 bacterial: kanamycin
236 HsUT00698201 Plasmid Details 3'UTR HAND1 heart and neural crest derivatives expressed 1 Sequence Verified: Yes; 3'UTR length: 1014; Forward Primer: CTGGAGTTAAACCAGTGA; Reverse Primer: GAAATACATTCTTTATCTGCCGGCTTCC NM_004821 No/No NA P2RP3 bacterial: kanamycin
237 HsUT00698202 Plasmid Details 3'UTR BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 Sequence Verified: Yes; 3'UTR length: 1004; Forward Primer: TCCACCAGCACCTTTTGA; Reverse Primer: GTGAAACATCAAGGCGGCAG NM_004052 No/No NA P2RP3 bacterial: kanamycin
238 HsUT00698203 Plasmid Details 3'UTR SALL2 spalt-like transcription factor 2 Sequence Verified: Yes; 3'UTR length: 1786; Forward Primer: GATGACCCCACGATCCCATGA; Reverse Primer: AGGACAAGGCTGAATAAAGTAAATATTTCA NM_005407 No/No NA P2RP3 bacterial: kanamycin
239 HsUT00698204 Plasmid Details 3'UTR PRKRIR protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Sequence Verified: Yes; 3'UTR length: 1084; Forward Primer: GATAATTCCGAAACTGTGGAAAATACCTAA; Reverse Primer: TAACACTTTCTTAATTGTTTTTTTTCTGTA NM_004705 No/No NA P2RP3 bacterial: kanamycin
240 HsUT00698205 Plasmid Details 3'UTR STK40 serine/threonine kinase 40 Sequence Verified: Yes; 3'UTR length: 2311; Forward Primer: CGCTACCTGCGGAAATAA; Reverse Primer: GGGAGCAGGGAGGGGGCA NM_032017 No/No NA P2RP3 bacterial: kanamycin
241 HsUT00698206 Plasmid Details 3'UTR PRDM13 PR domain containing 13 Sequence Verified: Yes; 3'UTR length: 999; Forward Primer: GGGGAGCGCGACTTGTAA; Reverse Primer: TGGTATATTTCCCTGTTATAATACAACACT NM_021620 No/No NA P2RP3 bacterial: kanamycin
242 HsUT00698207 Plasmid Details 3'UTR ZNF813 zinc finger protein 813 Sequence Verified: Yes; 3'UTR length: 2386; Forward Primer: TTTAATGAGTGTGGCAAAGCTTTTAATTGA; Reverse Primer: CGAACTCTGGATCTCAGGTGATCC NM_001004301 No/No NA P2RP3 bacterial: kanamycin
243 HsUT00698208 Plasmid Details 3'UTR TNIK TRAF2 and NCK interacting kinase Sequence Verified: Yes; 3'UTR length: 1558; Forward Primer: CTCAACAGAAATTCCATGATGAACTGGTAA; Reverse Primer: GAGATAACACTGCTGTGATGAACAGTGAAA NM_001161562 No/No NA P2RP3 bacterial: kanamycin
244 HsUT00698209 Plasmid Details 3'UTR ING4 inhibitor of growth family, member 4 Sequence Verified: Yes; 3'UTR length: 988; Forward Primer: TTGCCTGTGTGGGGCTGA; Reverse Primer: CCCTGGTCTGAGGCCTAC NM_001127586 No/No NA P2RP3 bacterial: kanamycin
245 HsUT00698210 Plasmid Details 3'UTR PEX14 peroxisomal biogenesis factor 14 Sequence Verified: Yes; 3'UTR length: 951; Forward Primer: GAGAGTGAGCGGGACTAG; Reverse Primer: CACTGGACCTGAACAAGGCCT NM_004565 No/No NA P2RP3 bacterial: kanamycin
246 HsUT00698211 Plasmid Details 3'UTR DBX2 developing brain homeobox 2 Sequence Verified: Yes; 3'UTR length: 1710; Forward Primer: GTACTTACTGGGGCTGTCTGA; Reverse Primer: GCACATAGGAAGTACCCTATAAATGTAAAT NM_001004329 No/No NA P2RP3 bacterial: kanamycin
247 HsUT00698212 Plasmid Details 3'UTR ZC3HAV1 zinc finger CCCH-type, antiviral 1 Sequence Verified: Yes; 3'UTR length: 874; Forward Primer: ATGAAGAGAGGGCCAGAGTAA; Reverse Primer: TTTATCTTTTTAGTAACTTCCTTTTTCATC NM_024625 No/No NA P2RP3 bacterial: kanamycin
248 HsUT00698215 Plasmid Details 3'UTR LATS2 large tumor suppressor kinase 2 Sequence Verified: Yes; 3'UTR length: 2013; Forward Primer: CAGCCTGTGTACGTGTAG; Reverse Primer: TTTTCCACACCCCAAGACATTCCT NM_014572 No/No NA P2RP3 bacterial: kanamycin
249 HsUT00698216 Plasmid Details 3'UTR ZNF620 zinc finger protein 620 Sequence Verified: Yes; 3'UTR length: 1538; Forward Primer: CAGAAGACACCTGTCCAAGCATAG; Reverse Primer: AAACCTATGAGGTAGATTAACTGTCATCCT NM_001256168 No/No NA P2RP3 bacterial: kanamycin
250 HsUT00698217 Plasmid Details 3'UTR CTBP1 C-terminal binding protein 1 Sequence Verified: Yes; 3'UTR length: 980; Forward Primer: GCCAGTGACCAGTTGTAG; Reverse Primer: GACCACTGCCCAACCTGC NM_001328 No/No NA P2RP3 bacterial: kanamycin
251 HsUT00698218 Plasmid Details 3'UTR ZNF687 zinc finger protein 687 Sequence Verified: Yes; 3'UTR length: 876; Forward Primer: GCTGTTGGGGACAACTAG; Reverse Primer: CCAAGATACAAAAGGCACTACATAGAAGTT NM_020832 No/No NA P2RP3 bacterial: kanamycin
252 HsUT00698219 Plasmid Details 3'UTR THAP3 THAP domain containing, apoptosis associated protein 3 Sequence Verified: Yes; 3'UTR length: 1678; Forward Primer: TGGTTGAGTGAGGAGTGA; Reverse Primer: CCTTCTGATCACCTGCGTCTGTC NM_138350 No/No NA P2RP3 bacterial: kanamycin
253 HsUT00698220 Plasmid Details 3'UTR ZNF354A zinc finger protein 354A Sequence Verified: Yes; 3'UTR length: 719; Forward Primer: TATAAAATTCATATCGAAGAGGACCCCTAG; Reverse Primer: AAATTATTGCCTGTTTTTCTATCTAATACA NM_005649 No/No NA P2RP3 bacterial: kanamycin
254 HsUT00698221 Plasmid Details 3'UTR ZBTB7B zinc finger and BTB domain containing 7B Sequence Verified: Yes; 3'UTR length: 2020; Forward Primer: GGTGCCATGGAGTCCTCTTAA; Reverse Primer: ACCAGCCCTGAGCCCCAC NM_001252406 No/No NA P2RP3 bacterial: kanamycin
255 HsUT00698222 Plasmid Details 3'UTR ZNF648 zinc finger protein 648 Sequence Verified: Yes; 3'UTR length: 1914; Forward Primer: TCCTCCTCTGACGAGTGA; Reverse Primer: TATGGTTAACAAACAGCGCAGGTGA NM_001009992 No/No NA P2RP3 bacterial: kanamycin
256 HsUT00698223 Plasmid Details 3'UTR THRAP3 thyroid hormone receptor associated protein 3 Sequence Verified: Yes; 3'UTR length: 1519; Forward Primer: AATATACAGCCCACAACCGAGTAG; Reverse Primer: CCAGGAAGGACTGTGTCTGTCT NM_005119 No/No NA P2RP3 bacterial: kanamycin
257 HsUT00698224 Plasmid Details 3'UTR MGC27016 RNA binding motif protein 46 Sequence Verified: Yes; 3'UTR length: 926; Forward Primer: AATCAGGCCTCCTTCTTCTGA; Reverse Primer: AACAACTTTCTTCAACATCCTTCACTTGAG NM_144979 No/No NA P2RP3 bacterial: kanamycin
258 HsUT00698225 Plasmid Details 3'UTR ZNF646 zinc finger protein 646 Sequence Verified: Yes; 3'UTR length: 600; Forward Primer: CTCAGCTTCTCCCTCTGA; Reverse Primer: GGAAGGAACCTGCCTGGG NM_014699 No/No NA P2RP3 bacterial: kanamycin
259 HsUT00698226 Plasmid Details 3'UTR DDX43 DEAD (Asp-Glu-Ala-Asp) box polypeptide 43 Sequence Verified: Yes; 3'UTR length: 1520; Forward Primer: GGAAGGCCCAAGAAGTTTCATTAA; Reverse Primer: GGTAAACTGTTGTTGCATATTTTGACCTTA NM_018665 No/No NA P2RP3 bacterial: kanamycin
260 HsUT00698227 Plasmid Details 3'UTR RNF6 ring finger protein (C3H2C3 type) 6 Sequence Verified: Yes; 3'UTR length: 1236; Forward Primer: TTAGGGTCTAACATAGCAAACAATGGGTAA; Reverse Primer: CTAAGAGCAAATATGTCTTTTCCATGAAGC NM_005977 No/No NA P2RP3 bacterial: kanamycin
261 HsUT00698228 Plasmid Details 3'UTR PDK4 pyruvate dehydrogenase kinase, isozyme 4 Sequence Verified: Yes; 3'UTR length: 2324; Forward Primer: GCAAAAGAAGTGGCCATGTGA; Reverse Primer: TTAAATTTCCAGAAATATGCAGAAACATAT NM_002612 No/No NA P2RP3 bacterial: kanamycin
262 HsUT00698229 Plasmid Details 3'UTR SMAD1 SMAD family member 1 Sequence Verified: Yes; 3'UTR length: 1419; Forward Primer: CCTCATAATCCTATTTCATCTGTATCTTAA; Reverse Primer: TCCGGTCTCTTCATGCTGCT NM_001003688 No/No NA P2RP3 bacterial: kanamycin
263 HsUT00698230 Plasmid Details 3'UTR CRSP3 mediator complex subunit 23 Sequence Verified: Yes; 3'UTR length: 1121; Forward Primer: GTGTCTTTACCAGTAACTCAGTGA; Reverse Primer: GTTCTTTTTAAAAGAATCTGTAACTCTTAA NM_004830 No/No NA P2RP3 bacterial: kanamycin
264 HsUT00698231 Plasmid Details 3'UTR ZNF23 zinc finger protein 23 Sequence Verified: Yes; 3'UTR length: 673; Forward Primer: CAGAGTGTCCATAGTGAAGGAAAATCCTAA; Reverse Primer: TTTTAAACTTTAAAACAAAAACATACAGGA NM_145911 No/No NA P2RP3 bacterial: kanamycin
265 HsUT00698232 Plasmid Details 3'UTR BLK BLK proto-oncogene, Src family tyrosine kinase Sequence Verified: Yes; 3'UTR length: 671; Forward Primer: TACGAGCTGCAGCCCTAG; Reverse Primer: CGGATTTATGAGGCCACAGC NM_001715 No/No NA P2RP3 bacterial: kanamycin
266 HsUT00698233 Plasmid Details 3'UTR NR1H4 nuclear receptor subfamily 1, group H, member 4 Sequence Verified: Yes; 3'UTR length: 558; Forward Primer: ATCTGGGACGTGCAGTGA; Reverse Primer: GAATGACTATTCACCAGGACTTTTCCAGAG NM_001206977 No/No NA P2RP3 bacterial: kanamycin
267 HsUT00698234 Plasmid Details 3'UTR MESP1 mesoderm posterior basic helix-loop-helix transcription factor 1 Sequence Verified: Yes; 3'UTR length: 457; Forward Primer: CCTGAGGAGCCCAAGTGA; Reverse Primer: TAGATGCTGAGCCAGGGCT NM_018670 No/No NA P2RP3 bacterial: kanamycin
268 HsUT00698235 Plasmid Details 3'UTR CARM1 coactivator-associated arginine methyltransferase 1 Sequence Verified: Yes; 3'UTR length: 1195; Forward Primer: ATGCACTACGGGAGCTAG; Reverse Primer: CCCTGGAACAGGAGGGAGA NM_199141 No/No NA P2RP3 bacterial: kanamycin
269 HsUT00698236 Plasmid Details 3'UTR ZNF304 zinc finger protein 304 Sequence Verified: Yes; 3'UTR length: 2228; Forward Primer: CCTTTAGCTGCATCTCTTAAACTTGTTTAA; Reverse Primer: TGAGTTGAAAACATCTCCACAGAAAAACTA NM_020657 No/No NA P2RP3 bacterial: kanamycin
270 HsUT00698237 Plasmid Details 3'UTR ZNF20 zinc finger protein 20 Sequence Verified: Yes; 3'UTR length: 1414; Forward Primer: CATGAAAGAACTCATACCATTAATAGATGA; Reverse Primer: GAGATCGAGTCACTGCACTCCA NM_001203250 No/No NA P2RP3 bacterial: kanamycin
271 HsUT00698238 Plasmid Details 3'UTR CENPF centromere protein F, 350/400kDa Sequence Verified: Yes; 3'UTR length: 957; Forward Primer: GAGAACTGTAAGGTCCAGTGA; Reverse Primer: ATTGTGTCTTTTAATACAACTAAAGATGCT NM_016343 No/No NA P2RP3 bacterial: kanamycin
272 HsUT00698240 Plasmid Details 3'UTR OVOL2 ovo-like zinc finger 2 Sequence Verified: Yes; 3'UTR length: 664; Forward Primer: GAGGAGGAGGAGAGGAAGTGA; Reverse Primer: GTGACAGAGTGAGAACTTGTCTCAAAAACA NM_021220 No/No NA P2RP3 bacterial: kanamycin
273 HsUT00698241 Plasmid Details 3'UTR POU3F4 POU class 3 homeobox 4 Sequence Verified: Yes; 3'UTR length: 537; Forward Primer: GACACATCTTGCCATGATCTCTGA; Reverse Primer: CGACCAAACAAACCTTACTCTGAGTAAACA NM_000307 No/No NA P2RP3 bacterial: kanamycin
274 HsUT00698242 Plasmid Details 3'UTR PUS1 pseudouridylate synthase 1 Sequence Verified: Yes; 3'UTR length: 455; Forward Primer: GACGGAGACACTGACTGA; Reverse Primer: GCCTCCCAAGTGCTGGGATTA NM_025215 No/No NA P2RP3 bacterial: kanamycin
275 HsUT00698244 Plasmid Details 3'UTR PCAF K(lysine) acetyltransferase 2B Sequence Verified: Yes; 3'UTR length: 2059; Forward Primer: ATTAAGGAAGCTGGATTAATTGACAAGTGA; Reverse Primer: TGATGACCTATGGATTTTTTATGAAACCTC NM_003884 No/No NA P2RP3 bacterial: kanamycin
276 HsUT00698245 Plasmid Details 3'UTR NEK4 NIMA-related kinase 4 Sequence Verified: Yes; 3'UTR length: 1177; Forward Primer: AAATTTTTTGAAGAAAACATGAATTTTTGA; Reverse Primer: GCACACGCCTGTGGTCTCA NM_003157 No/No NA P2RP3 bacterial: kanamycin
277 HsUT00698246 Plasmid Details 3'UTR EED embryonic ectoderm development Sequence Verified: Yes; 3'UTR length: 928; Forward Primer: GAAGTAGAAGATCCTCATAAAGCCAAGTAA; Reverse Primer: TTCACTTTAGTTCTAGAGCCTATACTTAAT NM_152991 No/No NA P2RP3 bacterial: kanamycin
278 HsUT00698247 Plasmid Details 3'UTR TLE4 transducin-like enhancer of split 4 Sequence Verified: Yes; 3'UTR length: 1777; Forward Primer: AAGGCCACAGTTTATGAAGTTATTTATTAA; Reverse Primer: CCACATTACTTTAACAACAAAAAAAACCAC NM_007005 No/No NA P2RP3 bacterial: kanamycin
279 HsUT00698248 Plasmid Details 3'UTR ETV7 ets variant 7 Sequence Verified: Yes; 3'UTR length: 631; Forward Primer: AGGCCAGAAATCTCTCCGTGA; Reverse Primer: GGGCAGCTGTAATCCCAGCTA NM_016135 No/No NA P2RP3 bacterial: kanamycin
280 HsUT00698249 Plasmid Details 3'UTR HNRPL heterogeneous nuclear ribonucleoprotein L Sequence Verified: Yes; 3'UTR length: 514; Forward Primer: GCTCAGCACGCCTCCTAA; Reverse Primer: GACTCAATTGCTAGCACCATTCTCAGT NM_001533 No/No NA P2RP3 bacterial: kanamycin
281 HsUT00698250 Plasmid Details 3'UTR SUPT5H suppressor of Ty 5 homolog (S. cerevisiae) Sequence Verified: Yes; 3'UTR length: 449; Forward Primer: AAGCTCCTGGAAGCCTGA; Reverse Primer: AGATTTAGGTAGGGTCCAGTTATTTGC NM_001130824 No/No NA P2RP3 bacterial: kanamycin
282 HsUT00698252 Plasmid Details 3'UTR TRIP11 thyroid hormone receptor interactor 11 Sequence Verified: Yes; 3'UTR length: 1954; Forward Primer: GTTGTGCTGAAAGACCTTTTAAAGCAATAG; Reverse Primer: AAACTAGTATTTCATTTCTCCACACTGAAA NM_004239 No/No NA P2RP3 bacterial: kanamycin
283 HsUT00698253 Plasmid Details 3'UTR SRRM1 serine/arginine repetitive matrix 1 Sequence Verified: Yes; 3'UTR length: 1175; Forward Primer: GTGTCCCCACAGTCTTAG; Reverse Primer: TTCTAAATGTTCCAATCACATGCTGATTCC NM_005839 No/No NA P2RP3 bacterial: kanamycin
284 HsUT00698254 Plasmid Details 3'UTR MKRN3 makorin ring finger protein 3 Sequence Verified: Yes; 3'UTR length: 893; Forward Primer: CTGGAAGAATATTTCAATTTGATTCTGTAG; Reverse Primer: AGATCTGCATCTGTCACATTTGGC NM_005664 No/No NA P2RP3 bacterial: kanamycin
285 HsUT00698256 Plasmid Details 3'UTR LCK LCK proto-oncogene, Src family tyrosine kinase Sequence Verified: Yes; 3'UTR length: 629; Forward Primer: TACCAGCCTCAGCCTTGA; Reverse Primer: GGAGGGGTGAGGAGCACTG NM_005356 No/No NA P2RP3 bacterial: kanamycin
286 HsUT00698257 Plasmid Details 3'UTR SPZ1 spermatogenic leucine zipper 1 Sequence Verified: Yes; 3'UTR length: 513; Forward Primer: AAAATGAGGTCAGCTAGCAGCCTAAGATAG; Reverse Primer: GCTCAGGTTTGTCTCAAACTCCTG NM_032567 No/No NA P2RP3 bacterial: kanamycin
287 HsUT00698258 Plasmid Details 3'UTR RDM1 RAD52 motif containing 1 Sequence Verified: Yes; 3'UTR length: 441; Forward Primer: AGGCTGCCAGAACTTGACTAG; Reverse Primer: GTCACGTGAGGAGGGGCCAT NM_001163120 No/No NA P2RP3 bacterial: kanamycin
288 HsUT00698260 Plasmid Details 3'UTR SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 Sequence Verified: Yes; 3'UTR length: 1938; Forward Primer: ACATTACTAAAAACATCAATGGGCCTGTGA; Reverse Primer: AGAATACATCCTAAGTAGTAAGTTCCAATT NM_001128429 No/No NA P2RP3 bacterial: kanamycin
289 HsUT00698262 Plasmid Details 3'UTR MAP2K6 mitogen-activated protein kinase kinase 6 Sequence Verified: Yes; 3'UTR length: 756; Forward Primer: TCTTTTGTAAAACTGATTCTTGGAGACTAA; Reverse Primer: TTTTTATGTTTTCCAAAGTTGGGAAAAAGA NM_002758 No/No NA P2RP3 bacterial: kanamycin
290 HsUT00698264 Plasmid Details 3'UTR CHD8 chromodomain helicase DNA binding protein 8 Sequence Verified: Yes; 3'UTR length: 599; Forward Primer: TCCAGTGAAGATGCTGATGACTGA; Reverse Primer: TACCCTTTAGAGGAGTACAGATGACTTGTC NM_001170629 No/No NA P2RP3 bacterial: kanamycin
291 HsUT00698265 Plasmid Details 3'UTR PRRX2 paired related homeobox 2 Sequence Verified: Yes; 3'UTR length: 500; Forward Primer: GTGCCTACGGTGAACTGA; Reverse Primer: TGGCTGCTGGTCTGAGCC NM_016307 No/No NA P2RP3 bacterial: kanamycin
292 HsUT00698266 Plasmid Details 3'UTR ZNF638 zinc finger protein 638 Sequence Verified: Yes; 3'UTR length: 434; Forward Primer: GCTGAAGAAAGAAGCTCTAGGTGA; Reverse Primer: TGGTTGAAGCAAAGTAAAACACTGTCAT NM_001252613 No/No NA P2RP3 bacterial: kanamycin
293 HsUT00698267 Plasmid Details 3'UTR NEK5 NIMA-related kinase 5 Sequence Verified: Yes; 3'UTR length: 823; Forward Primer: GTGCTCATCCTGATGTGA; Reverse Primer: GGGAGGTGTACCCAACAGCT NM_199289 No/No NA P2RP3 bacterial: kanamycin
294 HsUT00698268 Plasmid Details 3'UTR PLRG1 pleiotropic regulator 1 Sequence Verified: Yes; 3'UTR length: 1868; Forward Primer: CCAGAAATTATCAAGAGAAAGAGATTTTAA; Reverse Primer: AACTTGAACACAATAGTTGAAGCTTTGCCA NM_001201564 No/No NA P2RP3 bacterial: kanamycin
295 HsUT00698269 Plasmid Details 3'UTR NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) Sequence Verified: Yes; 3'UTR length: 502; Forward Primer: GTTTAATTGCAGGCGCATTGA; Reverse Primer: TGCATTTTTAAAAGATTGAAAAGGTTTTCA NM_001037738 No/No NA P2RP3 bacterial: kanamycin
296 HsUT00698270 Plasmid Details 3'UTR CCT4 chaperonin containing TCP1, subunit 4 (delta) Sequence Verified: Yes; 3'UTR length: 745; Forward Primer: TTTTTCTCTTATCAGGTAAACACTCGATAA; Reverse Primer: TAAAGGGAAGAGACTAGTTACAGATTTGAC NM_006430 No/No NA P2RP3 bacterial: kanamycin
297 HsUT00698272 Plasmid Details 3'UTR ZNF274 zinc finger protein 274 Sequence Verified: Yes; 3'UTR length: 598; Forward Primer: AAGAAGAAACAGCCTACCTCATAG; Reverse Primer: ACTCACATAGTATCTTGTGCCCAAGG NM_133502 No/No NA P2RP3 bacterial: kanamycin
298 HsUT00698273 Plasmid Details 3'UTR LMO1 LIM domain only 1 (rhombotin 1) Sequence Verified: Yes; 3'UTR length: 492; Forward Primer: ACCTTTGAATCCCAAGTTCAGTAA; Reverse Primer: TTCCTCCCAGCTTCTTCCCCTAAA NM_001270428 No/No NA P2RP3 bacterial: kanamycin
299 HsUT00698274 Plasmid Details 3'UTR CRABP1 cellular retinoic acid binding protein 1 Sequence Verified: Yes; 3'UTR length: 433; Forward Primer: ACCAGAATTTATGTCCGAGAGTGA; Reverse Primer: CCAGCTTGCAACTGCTGACGTA NM_004378 No/No NA P2RP3 bacterial: kanamycin
300 HsUT00698275 Plasmid Details 3'UTR ZNF611 zinc finger protein 611 Sequence Verified: Yes; 3'UTR length: 2304; Forward Primer: CATAGAATTCATACTGGAGAGAAACCTTAG; Reverse Primer: TGGAGGAGCGTTCTATGCCAAT NM_030972 No/No NA P2RP3 bacterial: kanamycin
301 HsUT00698276 Plasmid Details 3'UTR ZNF257 zinc finger protein 257 Sequence Verified: Yes; 3'UTR length: 1839; Forward Primer: TCCTCAAACCTTACTAAACATAATTCATAA; Reverse Primer: CCTGGCCTCAATTGATCCGC NM_033468 No/No NA P2RP3 bacterial: kanamycin
302 HsUT00698278 Plasmid Details 3'UTR ZNF30 zinc finger protein 30 Sequence Verified: Yes; 3'UTR length: 514; Forward Primer: CTGAGAAAACATATGAGTGTTATACCCTAA; Reverse Primer: CTGTAAGGTGATAAGTGTAGTGCCTAATAT NM_194325 No/No NA P2RP3 bacterial: kanamycin
303 HsUT00698280 Plasmid Details 3'UTR FEZF2 FEZ family zinc finger 2 Sequence Verified: Yes; 3'UTR length: 591; Forward Primer: ACTAGGACAGTGCAGAGCTGA; Reverse Primer: CAGCAAGAACACCGGTTTGG NM_018008 No/No NA P2RP3 bacterial: kanamycin
304 HsUT00698281 Plasmid Details 3'UTR LHX5 LIM homeobox 5 Sequence Verified: Yes; 3'UTR length: 481; Forward Primer: GAAGCCGCCGTGTGGTAA; Reverse Primer: GGAAAGCACAGCGAGAAATAAGATTACAAA NM_022363 No/No NA P2RP3 bacterial: kanamycin
305 HsUT00698282 Plasmid Details 3'UTR FKHL18 forkhead box S1 Sequence Verified: Yes; 3'UTR length: 430; Forward Primer: CCAGGAATGTTCTTCTTTGAGTAA; Reverse Primer: ACTCCCTGAGAAAGTCCCCAG NM_004118 No/No NA P2RP3 bacterial: kanamycin
306 HsUT00698283 Plasmid Details 3'UTR CAND1 cullin-associated and neddylation-dissociated 1 Sequence Verified: Yes; 3'UTR length: 1958; Forward Primer: ACTAACTTGGAATCAATGGACACTAGTTAG; Reverse Primer: AAAAACAAAGCAAAACAAAACAAAACATGC NM_018448 No/No NA P2RP3 bacterial: kanamycin
307 HsUT00698284 Plasmid Details 3'UTR RBM11 RNA binding motif protein 11 Sequence Verified: Yes; 3'UTR length: 1259; Forward Primer: CGAAAGTCTAAGAAGAAGAAAAGATACTAG; Reverse Primer: ATTTGGGTGGGGACACAGAC NM_144770 No/No NA P2RP3 bacterial: kanamycin
308 HsUT00698285 Plasmid Details 3'UTR BOLL boule-like RNA-binding protein Sequence Verified: Yes; 3'UTR length: 1856; Forward Primer: TAACAGACAGTGTGGAGCATTCATTATTAA; Reverse Primer: AGTAGCTTCTCAAAATAAAGCTAAATTCTA NM_033030 No/No NA P2RP3 bacterial: kanamycin
309 HsUT00698286 Plasmid Details 3'UTR ZNF77 zinc finger protein 77 Sequence Verified: Yes; 3'UTR length: 451; Forward Primer: ACACATGCTGGAGCGTGA; Reverse Primer: AAAAAAAACAAGAAAGTAGGAATCAAAAAC NM_021217 No/No NA P2RP3 bacterial: kanamycin
310 HsUT00698287 Plasmid Details 3'UTR ATN1 atrophin 1 Sequence Verified: Yes; 3'UTR length: 721; Forward Primer: GAAAGCGACAAGCCACTGTAG; Reverse Primer: CAATTCTTCCCAGCCCCCACA NM_001940 No/No NA P2RP3 bacterial: kanamycin
311 HsUT00698288 Plasmid Details 3'UTR VRK1 vaccinia related kinase 1 Sequence Verified: Yes; 3'UTR length: 586; Forward Primer: TCAAGAACCAGAAAGAGAGTCCAGAAGTAA; Reverse Primer: AGATTTTCTCTCTCATGGATACGCTTCCTC NM_003384 No/No NA P2RP3 bacterial: kanamycin
312 HsUT00698289 Plasmid Details 3'UTR ZNF335 zinc finger protein 335 Sequence Verified: Yes; 3'UTR length: 480; Forward Primer: ACCCTGGCCGATGACTGA; Reverse Primer: TCATTGCCAGGCCTCTGCA NM_022095 No/No NA P2RP3 bacterial: kanamycin
313 HsUT00698290 Plasmid Details 3'UTR MCM5 minichromosome maintenance complex component 5 Sequence Verified: Yes; 3'UTR length: 427; Forward Primer: GTTCTCTACCGCCTCAAGTGA; Reverse Primer: ACTCAAGTCACGTGACTTACCCAGAA NM_006739 No/No NA P2RP3 bacterial: kanamycin
314 HsUT00698291 Plasmid Details 3'UTR HABP4 hyaluronan binding protein 4 Sequence Verified: Yes; 3'UTR length: 1478; Forward Primer: GATTTCCCTGCGCTGTCTTGA; Reverse Primer: AATAAATAAGAGACCAAAAGTAGGCTATCA NM_014282 No/No NA P2RP3 bacterial: kanamycin
315 HsUT00698292 Plasmid Details 3'UTR ZNF2 zinc finger protein 2 Sequence Verified: Yes; 3'UTR length: 2390; Forward Primer: GCCAAACAGGGAATAGACTGA; Reverse Primer: TAAAAAAGATGTCCATTGGAATCCTAAATT NM_001017396 No/No NA P2RP3 bacterial: kanamycin
316 HsUT00698294 Plasmid Details 3'UTR SNRPA small nuclear ribonucleoprotein polypeptide A Sequence Verified: Yes; 3'UTR length: 405; Forward Primer: AAGATCTCCTTTGCCAAGAAGTAG; Reverse Primer: TTGTAACCTGAGTTTGAACAATATTACTAC NM_004596 No/No NA P2RP3 bacterial: kanamycin
317 HsUT00698295 Plasmid Details 3'UTR VPS25 vacuolar protein sorting 25 homolog (S. cerevisiae) Sequence Verified: Yes; 3'UTR length: 710; Forward Primer: GGCGTCAAGTTCTTCTAG; Reverse Primer: CCCACAGGGCCCTGGAGG NM_032353 No/No NA P2RP3 bacterial: kanamycin
318 HsUT00698296 Plasmid Details 3'UTR HMGA2 high mobility group AT-hook 2 Sequence Verified: Yes; 3'UTR length: 577; Forward Primer: AACAGTACCAAAAGGAGTCACTGA; Reverse Primer: CTGGCAGAAGTCATGGCAGC NM_003484 No/No NA P2RP3 bacterial: kanamycin
319 HsUT00698297 Plasmid Details 3'UTR AEBP1 AE binding protein 1 Sequence Verified: Yes; 3'UTR length: 479; Forward Primer: ACAGTGAACTTTGGGGACTTCTGA; Reverse Primer: AAGCCTGAGCACTTGCTGATG NM_001129 No/No NA P2RP3 bacterial: kanamycin
320 HsUT00698298 Plasmid Details 3'UTR ZNF454 zinc finger protein 454 Sequence Verified: Yes; 3'UTR length: 424; Forward Primer: CATCAGAGACATCATATTGGAGAGAAGTGA; Reverse Primer: CTGCCTCCCGGGTTCATG NM_001178090 No/No NA P2RP3 bacterial: kanamycin
321 HsUT00698299 Plasmid Details 3'UTR SRPK1 SRSF protein kinase 1 Sequence Verified: Yes; 3'UTR length: 2450; Forward Primer: CCTTGGCTTAACTCCTAA; Reverse Primer: AAACTATGAACCCCACAAAATGGCAAG NM_003137 No/No NA P2RP3 bacterial: kanamycin
322 HsUT00698300 Plasmid Details 3'UTR ZNF234 zinc finger protein 234 Sequence Verified: Yes; 3'UTR length: 2370; Forward Primer: GGAGGAAGTTCTACAAGGTGA; Reverse Primer: GCCCATATTTTTTCTTTATCCTGTCATTAC NM_001144824 No/No NA P2RP3 bacterial: kanamycin
323 HsUT00698301 Plasmid Details 3'UTR ZNF302 zinc finger protein 302 Sequence Verified: Yes; 3'UTR length: 1340; Forward Primer: CATACTGAAGAAAAACCGTTTGAAGTTTAG; Reverse Primer: TATGGACTCAATAATCCTCACCAAAATACT NM_018443 No/No NA P2RP3 bacterial: kanamycin
324 HsUT00698303 Plasmid Details 3'UTR LDB1 LIM domain binding 1 Sequence Verified: Yes; 3'UTR length: 705; Forward Primer: TCACAGGCCTCCCAGTAA; Reverse Primer: GTCTGAAGCTCTCACACCATATAAAATGGT NM_003893 No/No NA P2RP3 bacterial: kanamycin
325 HsUT00698304 Plasmid Details 3'UTR LENG9 leukocyte receptor cluster (LRC) member 9 Sequence Verified: Yes; 3'UTR length: 471; Forward Primer: GAGATCCGCCTGGAGTGA; Reverse Primer: CTCTCCGCATTCTTCCCTTGGTT NM_198988 No/No NA P2RP3 bacterial: kanamycin
326 HsUT00698305 Plasmid Details 3'UTR MOV10L1 Mov10 RISC complex RNA helicase like 1 Sequence Verified: Yes; 3'UTR length: 418; Forward Primer: CATCAGGAGCCCAGCTGA; Reverse Primer: CTGGCAGCCTTGCCTGGA NM_001164106 No/No NA P2RP3 bacterial: kanamycin
327 HsUT00698306 Plasmid Details 3'UTR MAPK10 mitogen-activated protein kinase 10 Sequence Verified: Yes; 3'UTR length: 2416; Forward Primer: GCACAGGTGCAGCAGTGA; Reverse Primer: CAGTAAAGAATTAGAGATACAGAGAGGAGA NM_002753 No/No NA P2RP3 bacterial: kanamycin
328 HsUT00698307 Plasmid Details 3'UTR KDR kinase insert domain receptor Sequence Verified: Yes; 3'UTR length: 1862; Forward Primer: CTGAGCTCTCCTCCTGTTTAA; Reverse Primer: TCAAAATAGTTGTGGTGATATTATACCCTC NM_002253 No/No NA P2RP3 bacterial: kanamycin
329 HsUT00698308 Plasmid Details 3'UTR GTF2A2 general transcription factor IIA, 2, 12kDa Sequence Verified: Yes; 3'UTR length: 1250; Forward Primer: CTAGATACTGGCTCCAATACTACAGAATGA; Reverse Primer: CATTTCATCCATTAAAACCAGTTTTCATAT NM_004492 No/No NA P2RP3 bacterial: kanamycin
330 HsUT00698310 Plasmid Details 3'UTR PRKACG protein kinase, cAMP-dependent, catalytic, gamma Sequence Verified: Yes; 3'UTR length: 684; Forward Primer: AAGTGTGCCAAGGAGTTTTCTGAGTTTTAG; Reverse Primer: CCCCAGAGCCTCCTTCCAAA NM_002732 No/No NA P2RP3 bacterial: kanamycin
331 HsUT00698311 Plasmid Details 3'UTR SNRPF small nuclear ribonucleoprotein polypeptide F Sequence Verified: Yes; 3'UTR length: 569; Forward Primer: GAGGAAGAAGATGGGGAAATGAGAGAATAG; Reverse Primer: TCAGTTCCCAATTTCTGTTGTGCC NM_003095 No/No NA P2RP3 bacterial: kanamycin
332 HsUT00698312 Plasmid Details 3'UTR NPR2 natriuretic peptide receptor 2 Sequence Verified: Yes; 3'UTR length: 466; Forward Primer: GGACCTCCTGGACTCCTGTAA; Reverse Primer: GAGGTCGGGAGGAAGTTAATTCTCAC NM_003995 No/No NA P2RP3 bacterial: kanamycin
333 HsUT00698313 Plasmid Details 3'UTR DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 Sequence Verified: Yes; 3'UTR length: 412; Forward Primer: TGCAGTGTATTGCCAAAACTGATTAGCTAG; Reverse Primer: CCAAATTACCCCTCCAGAACAGATG NM_003582 No/No NA P2RP3 bacterial: kanamycin
334 HsUT00698314 Plasmid Details 3'UTR JAZF1 JAZF zinc finger 1 Sequence Verified: Yes; 3'UTR length: 2406; Forward Primer: GCTGAGATTATCAGGAAGATGCAGCAATAA; Reverse Primer: TAATCTAATCTAAGCAAAAATGTAAGGGAA NM_175061 No/No NA P2RP3 bacterial: kanamycin
335 HsUT00698315 Plasmid Details 3'UTR ZNF845 zinc finger protein 845 Sequence Verified: Yes; 3'UTR length: 1461; Forward Primer: CATAGAATTCATACTGGAAAGAAACATTAG; Reverse Primer: TAAACCCGAAAGGCAGAGGCT NM_138374 No/No NA P2RP3 bacterial: kanamycin
336 HsUT00698316 Plasmid Details 3'UTR TDRKH tudor and KH domain containing Sequence Verified: Yes; 3'UTR length: 1153; Forward Primer: GATAACCTTGAAGATGACTACTTACTCTGA; Reverse Primer: GGTTATTTCTGAAGTGACTTTAGAGAAAGA NM_001083963 No/No NA P2RP3 bacterial: kanamycin
337 HsUT00698317 Plasmid Details 3'UTR TLR2 toll-like receptor 2 Sequence Verified: Yes; 3'UTR length: 1008; Forward Primer: GTAAATCTGAGAGCTGCGATAAAGTCCTAG; Reverse Primer: ACTGAGTATTTATTTTGTTAAATTACAGAA NM_003264 No/No NA P2RP3 bacterial: kanamycin
338 HsUT00698318 Plasmid Details 3'UTR MAPK12 mitogen-activated protein kinase 12 Sequence Verified: Yes; 3'UTR length: 679; Forward Primer: AAGGAGACGCCTCTGTGA; Reverse Primer: GGCACCAGCTTTGTGGCC NM_002969 No/No NA P2RP3 bacterial: kanamycin
339 HsUT00698319 Plasmid Details 3'UTR IRX3 iroquois homeobox 3 Sequence Verified: Yes; 3'UTR length: 566; Forward Primer: TTATCGGCTCTCTCCTCATCCTAG; Reverse Primer: ACTTCTGCGCCTCCTCAGCTAT NM_024336 No/No NA P2RP3 bacterial: kanamycin
340 HsUT00698320 Plasmid Details 3'UTR NOTO notochord homeobox Sequence Verified: Yes; 3'UTR length: 463; Forward Primer: TCAGGAGTGGACGGCTGA; Reverse Primer: GTGTTGATTGTTGTGGGGTGACA NM_001134462 No/No NA P2RP3 bacterial: kanamycin
341 HsUT00698321 Plasmid Details 3'UTR JOSD3 TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa Sequence Verified: Yes; 3'UTR length: 411; Forward Primer: CAGAGAGGCCTGAAAATGTGA; Reverse Primer: ACAGCATTTCAAATCCCCTCTTCAAGAT NM_024116 No/No NA P2RP3 bacterial: kanamycin
342 HsUT00698322 Plasmid Details 3'UTR ZGPAT zinc finger, CCCH-type with G patch domain Sequence Verified: Yes; 3'UTR length: 403; Forward Primer: CACAAGAAGATGACTGAGTTCTAG; Reverse Primer: ACCCTGGCCTCCGATCTG NM_001195654 No/No NA P2RP3 bacterial: kanamycin
343 HsUT00698323 Plasmid Details 3'UTR ZNF514 zinc finger protein 514 Sequence Verified: Yes; 3'UTR length: 1807; Forward Primer: AGAAGTCATGCTGGAAAAAAAACCCTATAA; Reverse Primer: GTTTCTGAAGATCTGCCATTTCTGGACATT NM_032788 No/No NA P2RP3 bacterial: kanamycin
344 HsUT00698324 Plasmid Details 3'UTR BLNK B-cell linker Sequence Verified: Yes; 3'UTR length: 454; Forward Primer: AGACTGAAGTATGCAGTTAAAGTTTCATAA; Reverse Primer: TAAAATTTTAACCAAGACTTAATTGTCAAG NM_001258441 No/No NA P2RP3 bacterial: kanamycin
345 HsUT00698325 Plasmid Details 3'UTR PNKP polynucleotide kinase 3'-phosphatase Sequence Verified: Yes; 3'UTR length: 225; Forward Primer: CAGTTCTCCGAGGGCTGA; Reverse Primer: TCATGCCAGGTCCCAGCT NM_007254 No/No NA P2RP3 bacterial: kanamycin
346 HsUT00698326 Plasmid Details 3'UTR DDIT3 DNA-damage-inducible transcript 3 Sequence Verified: Yes; 3'UTR length: 401; Forward Primer: GTGAATCTGCACCAAGCATGA; Reverse Primer: AAACATTGTCCGAGAACTGAAAGCACAA NM_004083 No/No NA P2RP3 bacterial: kanamycin
347 HsUT00698327 Plasmid Details 3'UTR ZNF347 zinc finger protein 347 Sequence Verified: Yes; 3'UTR length: 1784; Forward Primer: AAACCTTGCAAGCCATCACAGAATTCATAG; Reverse Primer: TGAAAACTGCACTTTCTATGGGATTTTCAT NM_001172675 No/No NA P2RP3 bacterial: kanamycin
348 HsUT00698328 Plasmid Details 3'UTR XRCC4 X-ray repair complementing defective repair in Chinese hamster cells 4 Sequence Verified: Yes; 3'UTR length: 698 NM_022550 No/No NA P2RP3 bacterial: kanamycin
349 HsUT00698329 Plasmid Details 3'UTR AKT1 v-akt murine thymoma viral oncogene homolog 1 Sequence Verified: Yes; 3'UTR length: 1171; Forward Primer: GCCAGCGGCACGGCCTGA; Reverse Primer: ACACAGCCTGTCCCCAAAC NM_001014431 No/No NA P2RP3 bacterial: kanamycin
350 HsUT00698330 Plasmid Details 3'UTR WNT3A wingless-type MMTV integration site family, member 3A Sequence Verified: Yes; 3'UTR length: 1986; Forward Primer: GTGCACACCTGCAAGTAG; Reverse Primer: TGCTGACCCACCACCAAACAT NM_033131 No/No NA P2RP3 bacterial: kanamycin
351 HsUT00698331 Plasmid Details 3'UTR ZNF780A zinc finger protein 780A Sequence Verified: Yes; 3'UTR length: 1704; Forward Primer: ACAGGTGAGAAGGCATCTTGA; Reverse Primer: ATTTGAGCGCCTACATTCATAGGATTTC NM_001142577 No/No NA P2RP3 bacterial: kanamycin
352 HsUT00698332 Plasmid Details 3'UTR ELF4 E74-like factor 4 (ets domain transcription factor) Sequence Verified: Yes; 3'UTR length: 1981; Forward Primer: CTCATTAAGATGGAGCCCCATGACATATAA; Reverse Primer: GACCTTCCAGCAATGAGTTTCCATG NM_001421 No/No NA P2RP3 bacterial: kanamycin
353 HsUT00698333 Plasmid Details 3'UTR IRAK2 interleukin-1 receptor-associated kinase 2 Sequence Verified: Yes; 3'UTR length: 1695; Forward Primer: GAGCTCTTTGGCCCCTGA; Reverse Primer: AACTCCCTAACTGGGCCCAAGA NM_001570 No/No NA P2RP3 bacterial: kanamycin
354 HsUT00698334 Plasmid Details 3'UTR TP53 tumor protein p53 Sequence Verified: Yes; 3'UTR length: 1387; Forward Primer: GGGCCTGACTCAGACTGA; Reverse Primer: CAGACTGACCCAGTCTCCAG NM_001126118 No/No NA P2RP3 bacterial: kanamycin
355 HsUT00698336 Plasmid Details 3'UTR ZNF551 zinc finger protein 551 Sequence Verified: Yes; 3'UTR length: 1693; Forward Primer: GTTCACACTGAAGAAAGGCCTTAA; Reverse Primer: CTGAGTCACAAAAGCCACATCCCT NM_138347 No/No NA P2RP3 bacterial: kanamycin
356 HsUT00698338 Plasmid Details 3'UTR RBM24 RNA binding motif protein 24 Sequence Verified: Yes; 3'UTR length: 1929; Forward Primer: CAGACAGACCGAATGCAATAG; Reverse Primer: CTTACTTTAAAGGCACAAAACCAGGACATC NM_001143942 No/No NA P2RP3 bacterial: kanamycin
357 HsUT00698339 Plasmid Details 3'UTR ZNF585A zinc finger protein 585A Sequence Verified: Yes; 3'UTR length: 1670; Forward Primer: CAGAGCAGCCACGCTTGA; Reverse Primer: GCAATGTGGGAAATTGGGAATCAG NM_199126 No/No NA P2RP3 bacterial: kanamycin
358 HsUT00698340 Plasmid Details 3'UTR XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 Sequence Verified: Yes; 3'UTR length: 413; Forward Primer: AAGCACTTCCAGGACTGA; Reverse Primer: CTGACCCGTCACACTCTCAC NM_001469 No/No NA P2RP3 bacterial: kanamycin
359 HsUT00698341 Plasmid Details 3'UTR HOXB9 homeobox B9 Sequence Verified: Yes; 3'UTR length: 1923; Forward Primer: AAAATGAATAAGGAGCAGGGCAAAGAGTAA; Reverse Primer: GAGCTCTGCAGGGGACCTT NM_024017 No/No NA P2RP3 bacterial: kanamycin
360 HsUT00698342 Plasmid Details 3'UTR ZNF71 zinc finger protein 71 Sequence Verified: Yes; 3'UTR length: 1599; Forward Primer: CTGCGGATTCACACCTGA; Reverse Primer: ACAGCTATGGCTCCAATGATGAGA NM_021216 No/No NA P2RP3 bacterial: kanamycin
361 HsUT00698343 Plasmid Details 3'UTR SAP18 Sin3A-associated protein, 18kDa Sequence Verified: Yes; 3'UTR length: 1923; Forward Primer: GGGCGCATGAGACCATATTAA; Reverse Primer: CGTCCCAGTTTTTGTACACCGTGAAA NM_005870 No/No NA P2RP3 bacterial: kanamycin
362 HsUT00698344 Plasmid Details 3'UTR TXNIP thioredoxin interacting protein Sequence Verified: Yes; 3'UTR length: 1590; Forward Primer: CTCAACAACAATGTGCAGTGA; Reverse Primer: GCCCCCACTCTGCCGACA NM_006472 No/No NA P2RP3 bacterial: kanamycin
363 HsUT00698345 Plasmid Details 3'UTR TRFP mediator complex subunit 20 Sequence Verified: Yes; 3'UTR length: 1898; Forward Primer: GTGGCTGGGATTCGTTAG; Reverse Primer: ACCACGATCAACTTCTGGAGATTTTCA NM_004275 No/No NA P2RP3 bacterial: kanamycin
364 HsUT00698346 Plasmid Details 3'UTR PAK6 p21 protein (Cdc42/Rac)-activated kinase 6 Sequence Verified: Yes; 3'UTR length: 1573; Forward Primer: CAGACCTCCACCTGCTGA; Reverse Primer: CCACAGGCCACCAGGGAA NM_001128629 No/No NA P2RP3 bacterial: kanamycin
365 HsUT00698347 Plasmid Details 3'UTR ATG5 autophagy related 5 Sequence Verified: Yes; 3'UTR length: 2243; Forward Primer: ATTAGTATCATCCCACAGCCAACAGATTGA; Reverse Primer: TATTGGGGGTCTTCTCCAATTTTCTTTTAT NM_004849 No/No NA P2RP3 bacterial: kanamycin
366 HsUT00698348 Plasmid Details 3'UTR SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 Sequence Verified: Yes; 3'UTR length: 1891; Forward Primer: CTGGGAATCCGGAATACATAG; Reverse Primer: GCAGACAGCAATCTCTTAAGGTAAGAC NM_139071 No/No NA P2RP3 bacterial: kanamycin
367 HsUT00698349 Plasmid Details 3'UTR SAMD4B sterile alpha motif domain containing 4B Sequence Verified: Yes; 3'UTR length: 1550; Forward Primer: GACAAAACCTCCACCATCTGA; Reverse Primer: ACCCCCTGGCTTCTTCCC NM_018028 No/No NA P2RP3 bacterial: kanamycin
368 HsUT00698350 Plasmid Details 3'UTR LIG4 ligase IV, DNA, ATP-dependent Sequence Verified: Yes; 3'UTR length: 1230; Forward Primer: ttacaagaagaaaaccagtatttgatttaa; Reverse Primer: AGGGAGGCTCTGTCTCAAAAA NM_206937 No/No NA P2RP3 bacterial: kanamycin
369 HsUT00698351 Plasmid Details 3'UTR CIITA class II, major histocompatibility complex, transactivator Sequence Verified: Yes; 3'UTR length: 1860; Forward Primer: TCACGGATCAGCCTGAGATGA; Reverse Primer: CCAACAGCCAGCATTGCCT NM_000246 No/No NA P2RP3 bacterial: kanamycin
370 HsUT00698352 Plasmid Details 3'UTR ZNF75D zinc finger protein 75D Sequence Verified: Yes; 3'UTR length: 1526; Forward Primer: GCATGTCTAGTGTCTCCAAACTGA; Reverse Primer: CATGTGTGCATTTAATCCTCACAGTAGC NM_001185063 No/No NA P2RP3 bacterial: kanamycin
371 HsUT00698353 Plasmid Details 3'UTR TRAF2 TNF receptor-associated factor 2 Sequence Verified: Yes; 3'UTR length: 894; Forward Primer: GTGGACCTGACAGGGCTCTAA; Reverse Primer: GAGAACACAGCCTGGCTAGCTAG NM_021138 No/No NA P2RP3 bacterial: kanamycin
372 HsUT00698354 Plasmid Details 3'UTR SALL3 spalt-like transcription factor 3 Sequence Verified: Yes; 3'UTR length: 1827; Forward Primer: GAGGATAACAAGGAGATTGGTATCAACTAG; Reverse Primer: TCCTCTTACAATGATTGTTGATGCTGCT NM_171999 No/No NA P2RP3 bacterial: kanamycin
373 HsUT00698355 Plasmid Details 3'UTR ATG4B autophagy related 4B, cysteine peptidase Sequence Verified: Yes; 3'UTR length: 1831; Forward Primer: TCCTGTTCCTTCTAGATTCTTCTGATGTAG; Reverse Primer: TGCCAGGGCTGGGGACAC NM_178326 No/No NA P2RP3 bacterial: kanamycin
374 HsUT00698356 Plasmid Details 3'UTR ZNF134 zinc finger protein 134 Sequence Verified: Yes; 3'UTR length: 1045; Forward Primer: ACTGCAGGCAGGCTTTAG; Reverse Primer: CCCAATCCCAATTACTCACACTCAATATTT NM_003435 No/No NA P2RP3 bacterial: kanamycin
375 HsUT00698357 Plasmid Details 3'UTR THUMPD2 THUMP domain containing 2 Sequence Verified: Yes; 3'UTR length: 855; Forward Primer: TATAAGAAGTCGCACTCTTCTGGACTGTAG; Reverse Primer: GGAAAACAGATTTTATGACTTCTGCTTTGG NM_025264 No/No NA P2RP3 bacterial: kanamycin
376 HsUT00698358 Plasmid Details 3'UTR NEK3 NIMA-related kinase 3 Sequence Verified: Yes; 3'UTR length: 679; Forward Primer: GGCCTGTGCGACAGATAA; Reverse Primer: CCAAGCTTCCCAGGGCTGA NM_001146099 No/No NA P2RP3 bacterial: kanamycin
377 HsUT00698359 Plasmid Details 3'UTR TADA3L transcriptional adaptor 3 Sequence Verified: Yes; 3'UTR length: 567; Forward Primer: AAGCTGCTGGATGGGTAG; Reverse Primer: AGAAAGAGGTACTCAGAAAGTTCTCCCT NM_006354 No/No NA P2RP3 bacterial: kanamycin
378 HsUT00698360 Plasmid Details 3'UTR SYCP3 synaptonemal complex protein 3 Sequence Verified: Yes; 3'UTR length: 459; Forward Primer: CGGAAGTCTCTTCAATCCATGTTATTCTGA; Reverse Primer: TGTCATTAGAATCGGTTGTACAACTTAAGT NM_001177948 No/No NA P2RP3 bacterial: kanamycin
379 HsUT00698361 Plasmid Details 3'UTR NCOR1 nuclear receptor corepressor 1 Sequence Verified: Yes; 3'UTR length: 2382; Forward Primer: CTGTCGGATAGTGATGACTGA; Reverse Primer: CAGAAACTATACGGTTGACCTTCAAATAAT NM_006311 No/No NA P2RP3 bacterial: kanamycin
380 HsUT00698362 Plasmid Details 3'UTR DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Sequence Verified: Yes; 3'UTR length: 1884; Forward Primer: ATGCGGAAGAGGATGTGA; Reverse Primer: GCATTATTTTTCCAGTTGCCCCCTAGTTAT NM_024072 No/No NA P2RP3 bacterial: kanamycin
381 HsUT00698363 Plasmid Details 3'UTR ZNF345 zinc finger protein 345 Sequence Verified: Yes; 3'UTR length: 1458; Forward Primer: AAACTCTGCGAATTGGAAACTATAAATTGA; Reverse Primer: AAAGGAACTGAGGCCAGGAATG NM_001242476 No/No NA P2RP3 bacterial: kanamycin
382 HsUT00698364 Plasmid Details 3'UTR UPF3B UPF3 regulator of nonsense transcripts homolog B (yeast) Sequence Verified: Yes; 3'UTR length: 1032; Forward Primer: AGAAAAGAAGGAGGAGAGGAGTGA; Reverse Primer: TTTGGGTGAGATGCCTGCTTCTA NM_080632 No/No NA P2RP3 bacterial: kanamycin
383 HsUT00698365 Plasmid Details 3'UTR MSL3 male-specific lethal 3 homolog (Drosophila) Sequence Verified: Yes; 3'UTR length: 854; Forward Primer: AACCCCCGGGCAATTTATTAA; Reverse Primer: CTGCCAAGTGAGGCAAAACCAAA NM_001193270 No/No NA P2RP3 bacterial: kanamycin
384 HsUT00698366 Plasmid Details 3'UTR CASC5 cancer susceptibility candidate 5 Sequence Verified: Yes; 3'UTR length: 675; Forward Primer: CAGGACTGCCATTTCTACCACTAG; Reverse Primer: CGCAAGCCACCATGACTG NM_144508 No/No NA P2RP3 bacterial: kanamycin
385 HsUT00698367 Plasmid Details 3'UTR BUB1B BUB1 mitotic checkpoint serine/threonine kinase B Sequence Verified: Yes; 3'UTR length: 557; Forward Primer: GCTTTGCTCTTTCAGTGA; Reverse Primer: CCACCTAAAGAAATAGTTGGCTACTCTGTC NM_001211 No/No NA P2RP3 bacterial: kanamycin
386 HsUT00698368 Plasmid Details 3'UTR NEDD8 neural precursor cell expressed, developmentally down-regulated 8 Sequence Verified: Yes; 3'UTR length: 456; Forward Primer: GGTGGTCTTAGGCAGTGA; Reverse Primer: GAACTGGTTCCAACACACCACTAAGTA NM_006156 No/No NA P2RP3 bacterial: kanamycin
387 HsUT00698369 Plasmid Details 3'UTR KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog Sequence Verified: Yes; 3'UTR length: 2338; Forward Primer: GTGCACGACGATGTCTGA; Reverse Primer: CTGTTGAATCTCGAAGCATGTAAATCCTAG NM_000222 No/No NA P2RP3 bacterial: kanamycin
388 HsUT00698370 Plasmid Details 3'UTR TAF4B TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa Sequence Verified: Yes; 3'UTR length: 1854; Forward Primer: TACCTGGCCCTTCTGAAGTGA; Reverse Primer: GATCTGAAGTGACTTTCTGGAACCAAAATG NM_005640 No/No NA P2RP3 bacterial: kanamycin
389 HsUT00698371 Plasmid Details 3'UTR RFC3 replication factor C (activator 1) 3, 38kDa Sequence Verified: Yes; 3'UTR length: 1392; Forward Primer: GGATTGGAAGGCATGATGTTCTGA; Reverse Primer: TCTCTTATATTGCTGGTAGAAGTGTAAAGT NM_002915 No/No NA P2RP3 bacterial: kanamycin
390 HsUT00698372 Plasmid Details 3'UTR HNRNPG-T RNA binding motif protein, X-linked-like 2 Sequence Verified: Yes; 3'UTR length: 1029; Forward Primer: GGCCGGAGCAGATACTAA; Reverse Primer: GCTCTTTCAGGGATTCTCTGACCTTT NM_014469 No/No NA P2RP3 bacterial: kanamycin
391 HsUT00698373 Plasmid Details 3'UTR HOXC9 homeobox C9 Sequence Verified: Yes; 3'UTR length: 842; Forward Primer: ACCGACAAGGAGCAGTCCTAA; Reverse Primer: CTGCAGAAGCAGACGTTTGC NM_006897 No/No NA P2RP3 bacterial: kanamycin
392 HsUT00698374 Plasmid Details 3'UTR ZNF17 zinc finger protein 17 Sequence Verified: Yes; 3'UTR length: 638; Forward Primer: CACCAGAAAGTTCACACCAGATAA; Reverse Primer: AGCCTACAGTATTCAGTACAGTAATATGCT NM_006959 No/No NA P2RP3 bacterial: kanamycin
393 HsUT00698375 Plasmid Details 3'UTR ERG v-ets avian erythroblastosis virus E26 oncogene homolog Sequence Verified: Yes; 3'UTR length: 554; Forward Primer: TTTTGTATAGGTTGGACCCAATGA; Reverse Primer: CCAAAGGTATTTCAGAAGCAGAGAGAG NM_001243432 No/No NA P2RP3 bacterial: kanamycin
394 HsUT00698376 Plasmid Details 3'UTR IFI16 interferon, gamma-inducible protein 16 Sequence Verified: Yes; 3'UTR length: 434; Forward Primer: ATGGAAACTTCACCAGACTTTTTCTTCTAA; Reverse Primer: CTTGATCAGGGCTTTACCCGGTAAA NM_005531 No/No NA P2RP3 bacterial: kanamycin
395 HsUT00698377 Plasmid Details 3'UTR KCNIP3 Kv channel interacting protein 3, calsenilin Sequence Verified: Yes; 3'UTR length: 2208; Forward Primer: CAGCTGTTTGAGAATGTCATCTAG; Reverse Primer: CTGAGAATTTGAGCGGCATTCTCT NM_013434 No/No NA P2RP3 bacterial: kanamycin
396 HsUT00698378 Plasmid Details 3'UTR MEFV Mediterranean fever Sequence Verified: Yes; 3'UTR length: 1843; Forward Primer: CCTAGGTATTCAAATTTTCTTTGCAGTTAA; Reverse Primer: ACCCGCAGATTTTCCCATACAAAC NM_001198536 No/No NA P2RP3 bacterial: kanamycin
397 HsUT00698379 Plasmid Details 3'UTR ZFP62 ZFP62 zinc finger protein Sequence Verified: Yes; 3'UTR length: 1361; Forward Primer: ATGAGGATGCCTCTGTAG; Reverse Primer: GCACCTTCTAACTTCTGGTGAAACCA NM_152283 No/No NA P2RP3 bacterial: kanamycin
398 HsUT00698380 Plasmid Details 3'UTR CAMK1D calcium/calmodulin-dependent protein kinase ID Sequence Verified: Yes; 3'UTR length: 1027; Forward Primer: CACTCTGGAAGCAAGTGA; Reverse Primer: CAAAGTCCCCCGCAGAGAAGA NM_153498 No/No NA P2RP3 bacterial: kanamycin
399 HsUT00698381 Plasmid Details 3'UTR ZNF691 zinc finger protein 691 Sequence Verified: Yes; 3'UTR length: 842; Forward Primer: GGGAAAGATTCCAGCTGA; Reverse Primer: CTCAAAGGCCCCAGAAACTCAGT NM_015911 No/No NA P2RP3 bacterial: kanamycin
400 HsUT00698382 Plasmid Details 3'UTR THAP8 THAP domain containing 8 Sequence Verified: Yes; 3'UTR length: 635; Forward Primer: CGGATCCCCAGTGCATAA; Reverse Primer: ACTGCAGGGGTTGTTCGTC NM_152658 No/No NA P2RP3 bacterial: kanamycin
401 HsUT00698383 Plasmid Details 3'UTR MED27 mediator complex subunit 27 Sequence Verified: Yes; 3'UTR length: 527; Forward Primer: ATTCCAAGAATATTCCATTGGAAAGTCTGA; Reverse Primer: TCCATCATAAGGTCTCCAAATTGCCT NM_001253882 No/No NA P2RP3 bacterial: kanamycin
402 HsUT00698384 Plasmid Details 3'UTR LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) Sequence Verified: Yes; 3'UTR length: 433; Forward Primer: CCACTGAGAGTTGGCTGA; Reverse Primer: CAGTAGGTGCACTGCAAATGTGT NM_014463 No/No NA P2RP3 bacterial: kanamycin
403 HsUT00698385 Plasmid Details 3'UTR ZNF532 zinc finger protein 532 Sequence Verified: Yes; 3'UTR length: 2191; Forward Primer: AGGATGAGCTCAGCCGAGAAATAG; Reverse Primer: CCTCTGGGCATTTTTTAAAATTTTCTTGTA NM_018181 No/No NA P2RP3 bacterial: kanamycin
404 HsUT00698386 Plasmid Details 3'UTR ROCK1 Rho-associated, coiled-coil containing protein kinase 1 Sequence Verified: Yes; 3'UTR length: 1822; Forward Primer: TTTTCCCCCTCCCTCAACAGTTAA; Reverse Primer: GAAAAGATAGTCAAAAGAAAGGTTGTCAGA NM_005406 No/No NA P2RP3 bacterial: kanamycin
405 HsUT00698387 Plasmid Details 3'UTR NFX1 nuclear transcription factor, X-box binding 1 Sequence Verified: Yes; 3'UTR length: 1359; Forward Primer: ATAATTGACTATTTTGACGTCCAGGACTAA; Reverse Primer: CCCTCCAGTCACCTGTTCCT NM_002504 No/No NA P2RP3 bacterial: kanamycin
406 HsUT00698388 Plasmid Details 3'UTR DMRTB1 DMRT-like family B with proline-rich C-terminal, 1 Sequence Verified: Yes; 3'UTR length: 1003; Forward Primer: CAGGAGCAGTCCGACTAG; Reverse Primer: GAGGGCAGGAACTAAAAATAGGAACTAAGC NM_033067 No/No NA P2RP3 bacterial: kanamycin
407 HsUT00698389 Plasmid Details 3'UTR ZNF83 zinc finger protein 83 Sequence Verified: Yes; 3'UTR length: 829; Forward Primer: GCCGGAAAGAAATCTAACACATGTAATTAA; Reverse Primer: TGGTTGGCTAGGATGGTCTCAATCT NM_001105554 No/No NA P2RP3 bacterial: kanamycin
408 HsUT00698390 Plasmid Details 3'UTR TCF21 transcription factor 21 Sequence Verified: Yes; 3'UTR length: 633; Forward Primer: GGAACCACCGCGTCCTGA; Reverse Primer: TCTTCATTATGAAACTCATATGCAATTTTC