DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Mineralocorticoid biosynthesis, 20 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00040028 Plasmid Details cDNA HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 NA BC031999 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00040722 Plasmid Details cDNA HSD3B2 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 NA BC038419 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00043178 Plasmid Details cDNA HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 NA BC031999 No/No CLOSED pDONR221 bacterial:kanamycin
4 HsCD00043847 Plasmid Details cDNA HSD3B2 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 NA BC038419 No/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00076980 Plasmid Details cDNA HSD3B2 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 NA BC038419 No/No FUSION pANT7_cGST bacterial:ampicillin
6 HsCD00082612 Plasmid Details cDNA CYP11B2 cytochrome P450, family 11, subfamily B, polypeptide 2 NA BC111458 No/No FUSION pENTR223.1 bacterial:spectinomycin
7 HsCD00289235 Plasmid Details cDNA CGA glycoprotein hormones, alpha polypeptide NA BC010957.1 No/No FUSION pENTR223 bacterial:spectinomycin
8 HsCD00295468 Plasmid Details cDNA LHB luteinizing hormone beta polypeptide NA NM_000894.2 No/No CLOSED pENTR223.1 bacterial:spectinomycin
9 HsCD00437670 Plasmid Details cDNA CGA glycoprotein hormones, alpha polypeptide NA HQ448725 No/No FUSION pLX304 mammalian:blasticidin
10 HsCD00438172 Plasmid Details cDNA HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 NA No/Yes FUSION pLX304 mammalian:blasticidin
11 HsCD00438470 Plasmid Details cDNA HSD3B2 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 NA No/No FUSION pLX304 mammalian:blasticidin
12 HsCD00443518 Plasmid Details cDNA CYP11B1 cytochrome P450, family 11, subfamily B, polypeptide 1 NA No/No FUSION pLX304 mammalian:blasticidin
13 HsCD00504852 Plasmid Details cDNA CGA glycoprotein hormones, alpha polypeptide NA HQ448725 No/No FUSION pENTR223 bacterial:spectinomycin
14 HsCD00514025 Plasmid Details cDNA CYP11B1 cytochrome P450, family 11, subfamily B, polypeptide 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
15 HsCD00622705 Plasmid Details cDNA HSD3B2 "hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2" PERFECT_MATCH BC038419.1 No/No FUSION pENTR223 bacterial:spectinomycin
16 HsCD00640838 Plasmid Details cDNA CYP11B2 cytochrome P450, family 11, subfamily B, polypeptide 2 NA BC111458 No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsUT00699176 Plasmid Details 3'UTR TRSPAP1 tRNA selenocysteine 1 associated protein 1 Sequence Verified: Yes; 3'UTR length: 1089; Forward Primer: TCAGAGATCCCTGCCATGATGTAG; Reverse Primer: ACACTTCCTTTGCAGGACAATCTCTAT NM_017846 No/No NA P2RP3 bacterial:kanamycin
18 HsCD00719279 Plasmid Details cDNA CYP21A2 cytochrome P450, family 21, subfamily A, polypeptide 2 NA BC125181 No/No FUSION pDONR221 bacterial:kanamycin
19 HsCD00731976 Plasmid Details cDNA HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 NA BC031999 No/No FUSION pANT7_cGST bacterial:ampicillin
20 HsCD00732235 Plasmid Details cDNA CGA glycoprotein hormones, alpha polypeptide NA BC010957 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: