DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Minus-strand DNA synthesis, 9 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00041604 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00044677 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No CLOSED pDONR221 bacterial:kanamycin
3 HsCD00434362 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pLX304 mammalian:blasticidin
4 HsCD00440961 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pLX304 mammalian:blasticidin
5 HsCD00506343 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pENTR223 bacterial:spectinomycin
6 HsCD00506397 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pENTR223 bacterial:spectinomycin
7 HsUT00699294 Plasmid Details 3'UTR NHEJ1 nonhomologous end-joining factor 1 Sequence Verified: Yes; 3'UTR length: 1237; Forward Primer: AAGCCAAGGGGTCTCTTCAGTTAA; Reverse Primer: GACCTTTGATAAGTCACTTACTCACTTCAG NM_024782 No/No NA P2RP3 bacterial:kanamycin
8 HsCD00730944 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No FUSION pANT7_cGST bacterial:ampicillin
9 HsCD00817214 Plasmid Details cDNA PPIA peptidylprolyl isomerase A "insert_ID 28297,DNASU_Clone_ID HsCD00041604" BC000689 No/No FUSION pJFT7_nHalo_DC(r4) bacterial:ampicillin
No of Result Per Page : Page: