DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Mitochondrial ABC transporters, 17 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00003948 Plasmid Details cDNA ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 NA BC006323 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00003949 Plasmid Details cDNA ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 NA BC006323 No/No CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00040825 Plasmid Details cDNA ABCB6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 NA BC000559 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00042709 Plasmid Details cDNA ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 NA BC006323 No/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00043949 Plasmid Details cDNA ABCB6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 NA BC000559 No/No CLOSED pDONR221 bacterial:kanamycin
6 HsCD00074640 Plasmid Details cDNA ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 NA BC006323 No/No CLOSED pJP1520 mammalian:puromycin
7 HsCD00075907 Plasmid Details cDNA ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 NA BC006323 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00433654 Plasmid Details cDNA ABCB8 ATP-binding cassette, sub-family B (MDR/TAP), member 8 NA No/No FUSION pPICZa bacterial:zeocin
9 HsCD00437059 Plasmid Details cDNA ABCB8 ATP-binding cassette, sub-family B (MDR/TAP), member 8 NA No/Yes FUSION pLX304 mammalian:blasticidin
10 HsCD00442112 Plasmid Details cDNA ABCB6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 NA No/Yes FUSION pLX304 mammalian:blasticidin
11 HsCD00583713 Plasmid Details cDNA ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
12 HsCD00583714 Plasmid Details cDNA ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
13 HsCD00598206 Plasmid Details cDNA ABCB10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
14 HsCD00627301 Plasmid Details cDNA ABCB7 ATP-binding cassette, sub-family B (MDR/TAP), member 7 codon-optimized sequence No/No CLOSED pPICZa bacterial:zeocin
15 HsCD00627302 Plasmid Details cDNA ABCB6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 codon-optimized sequence No/No CLOSED pPICZa bacterial:zeocin
16 HsUT00699157 Plasmid Details 3'UTR PRKCZ protein kinase C, zeta Sequence Verified: Yes; 3'UTR length: 566; Forward Primer: ACCGAGGAGTCGGTGTGA; Reverse Primer: AAACAATTCTTGATTGCGGTGTGTC NM_002744 No/No NA P2RP3 bacterial:kanamycin
17 HsCD00731422 Plasmid Details cDNA ABCB6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group) NA BC000559 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: