DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Adenine and hypoxanthine salvage pathway, 25 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00001116 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) NA NM_000194 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00001117 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) NA NM_000194 No/No CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00001118 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) NA NM_000194 No/No CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00022127 Plasmid Details cDNA ADA adenosine deaminase NA NM_000022 No/Yes FUSION pDNR-Dual bacterial:ampicillin
5 HsCD00040869 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) NA BC000578 No/No FUSION pDONR221 bacterial:kanamycin
6 HsCD00040871 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) NA NM_000194 No/No FUSION pDONR221 bacterial:kanamycin
7 HsCD00041663 Plasmid Details cDNA ADA adenosine deaminase NA BC007678 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00044733 Plasmid Details cDNA ADA adenosine deaminase NA BC007678 No/No CLOSED pDONR221 bacterial:kanamycin
9 HsCD00074465 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) NA NM_000194 No/No CLOSED pJP1520 mammalian:puromycin
10 HsCD00076092 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) NA BC000578 No/No CLOSED pDONR221 bacterial:kanamycin
11 HsCD00076372 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) NA NM_000194 No/No FUSION pDONR221 bacterial:kanamycin
12 HsCD00294961 Plasmid Details cDNA XDH xanthine dehydrogenase NA NM_000379.3 No/No CLOSED pENTR223.1 bacterial:spectinomycin
13 HsCD00436807 Plasmid Details cDNA PNP purine nucleoside phosphorylase NA No/No FUSION pLX304 mammalian:blasticidin
14 HsCD00437859 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 NA EU176655 No/No FUSION pLX304 mammalian:blasticidin
15 HsCD00438445 Plasmid Details cDNA ADA adenosine deaminase NA DQ895924 No/No FUSION pLX304 mammalian:blasticidin
16 HsCD00443049 Plasmid Details cDNA APRT adenine phosphoribosyltransferase NA No/No FUSION pLX304 mammalian:blasticidin
17 HsCD00506610 Plasmid Details cDNA APRT adenine phosphoribosyltransferase NA No/No FUSION pENTR223 bacterial:spectinomycin
18 HsCD00507056 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 NA EU176655 No/No FUSION pENTR223 bacterial:spectinomycin
19 HsCD00509673 Plasmid Details cDNA PNP purine nucleoside phosphorylase NA No/No FUSION pENTR223 bacterial:spectinomycin
20 HsCD00510782 Plasmid Details cDNA ADA adenosine deaminase NA DQ895924 No/No FUSION pENTR223 bacterial:spectinomycin
21 HsCD00640941 Plasmid Details cDNA APRT adenine phosphoribosyltransferase NA NM_000485 No/No FUSION pANT7_cGST bacterial:ampicillin
22 HsCD00642165 Plasmid Details cDNA PNP purine nucleoside phosphorylase NA NM_000270 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsUT00698904 Plasmid Details 3'UTR RHOC ras homolog family member C Sequence Verified: Yes; 3'UTR length: 593; Forward Primer: GGCTGTCCCATTCTCTGA; Reverse Primer: GAGCCAGGCATGACCTCATC NM_175744 No/No NA P2RP3 bacterial:kanamycin
24 HsCD00730955 Plasmid Details cDNA ADA adenosine deaminase NA BC007678 No/No FUSION pANT7_cGST bacterial:ampicillin
25 HsCD00732448 Plasmid Details cDNA HPRT1 hypoxanthine phosphoribosyltransferase 1 NA NM_000194 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: