DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : N-acetylglucosamine metabolism, 29 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00003130 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA BC000012 No/No CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00003131 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA BC000012 No/No CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00041121 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA BC000012 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00044239 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA BC000012 No/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00287931 Plasmid Details cDNA GNPDA2 glucosamine-6-phosphate deaminase 2 NA BC015532.2 No/No FUSION pENTR223 bacterial:spectinomycin
6 HsCD00288281 Plasmid Details cDNA GNPDA1 glucosamine-6-phosphate deaminase 1 NA BC020769.1 No/No FUSION pENTR223 bacterial:spectinomycin
7 HsCD00303335 Plasmid Details cDNA GNPDA1 glucosamine-6-phosphate deaminase 1 NA BC020769.1 No/No FUSION pANT7_cGST bacterial:ampicillin
8 HsCD00352808 Plasmid Details cDNA GNPDA1 glucosamine-6-phosphate deaminase 1 NA HQ447787 No/No FUSION pDONR223 bacterial:spectinomycin
9 HsCD00353262 Plasmid Details cDNA GNPDA2 glucosamine-6-phosphate deaminase 2 NA HQ447377 No/No FUSION pDONR223 bacterial:spectinomycin
10 HsCD00357027 Plasmid Details cDNA GNPDA2 glucosamine-6-phosphate deaminase 2 NA HQ447377 No/No FUSION pANT7_cGST bacterial:ampicillin
11 HsCD00357976 Plasmid Details cDNA GNPDA1 glucosamine-6-phosphate deaminase 1 NA HQ447787 No/No FUSION pANT7_cGST bacterial:ampicillin
12 HsCD00434943 Plasmid Details cDNA GNPDA1 glucosamine-6-phosphate deaminase 1 NA HQ447787 No/No FUSION pLX304 mammalian:blasticidin
13 HsCD00439151 Plasmid Details cDNA NPL N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) NA No/No FUSION pLX304 mammalian:blasticidin
14 HsCD00441090 Plasmid Details cDNA GNPDA2 glucosamine-6-phosphate deaminase 2 NA HQ447377 No/No FUSION pLX304 mammalian:blasticidin
15 HsCD00441807 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA DQ895371 No/No FUSION pLX304 mammalian:blasticidin
16 HsCD00445869 Plasmid Details cDNA GNPDA1 glucosamine-6-phosphate deaminase 1 NA HQ447787 No/No FUSION pLX304 mammalian:blasticidin
17 HsCD00446741 Plasmid Details cDNA NPL N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) NA No/Yes FUSION pLX304 mammalian:blasticidin
18 HsCD00507788 Plasmid Details cDNA NPL N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) NA No/No FUSION pENTR223 bacterial:spectinomycin
19 HsCD00508751 Plasmid Details cDNA GNPDA2 glucosamine-6-phosphate deaminase 2 NA HQ447377 No/No FUSION pENTR223 bacterial:spectinomycin
20 HsCD00508817 Plasmid Details cDNA GNPDA1 glucosamine-6-phosphate deaminase 1 NA HQ447787 No/No FUSION pENTR223 bacterial:spectinomycin
21 HsCD00510544 Plasmid Details cDNA GNPDA1 glucosamine-6-phosphate deaminase 1 NA HQ447787 No/No FUSION pENTR223 bacterial:spectinomycin
22 HsCD00510633 Plasmid Details cDNA NPL N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) NA No/Yes FUSION pENTR223 bacterial:spectinomycin
23 HsCD00514451 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA DQ895371 No/No FUSION pENTR223 bacterial:spectinomycin
24 HsCD00545628 Plasmid Details cDNA GNPDA1 glucosamine-6-phosphate deaminase 1 NA No/No CLOSED pSpeedET bacterial:kanamycin
25 HsCD00619619 Plasmid Details cDNA GNPDA2 glucosamine-6-phosphate deaminase 2 NA BC015532 No/No FUSION pANT7_cGST bacterial:ampicillin
26 HsUT00697992 Plasmid Details 3'UTR UBE2B ubiquitin-conjugating enzyme E2B Sequence Verified: Yes; 3'UTR length: 1935; Forward Primer: ATTGTTGAACAAAGCTGGAATGATTCATAA; Reverse Primer: TTTAAACTGGGAAAGGCAAAAACAGGTC NM_003337 No/No NA P2RP3 bacterial:kanamycin
27 HsCD00731397 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA BC000012 No/No FUSION pANT7_cGST bacterial:ampicillin
28 HsCD00784828 Plasmid Details cDNA AMDHD2 amidohydrolase domain containing 2 NA NM_001145815 Yes/No FUSION pANT7_cGST bacterial:ampicillin
29 HsCD00813323 Plasmid Details cDNA AMDHD2 amidohydrolase domain containing 2 Source: Gene synthesis by Gen9; codon optimized NM_001145815 No/No FUSION pDONR221 bacterial:kanamycin
No of Result Per Page : Page: