DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Nicotinate metabolism, 39 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00003992 Plasmid Details cDNA QPRT quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase (carboxylating)) NA BC005060 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00003993 Plasmid Details cDNA QPRT quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase (carboxylating)) NA BC005060 No/No CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00003994 Plasmid Details cDNA QPRT quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase (carboxylating)) NA BC005060 No/No CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00022391 Plasmid Details cDNA NADK NAD kinase NA AK023114 No/Yes FUSION pDNR-Dual bacterial:ampicillin
5 HsCD00038587 Plasmid Details cDNA NADK NAD kinase NA AK023114 No/Yes FUSION pJP1520 mammalian:puromycin
6 HsCD00039035 Plasmid Details cDNA NADK NAD kinase NA AK023114 No/Yes FUSION pJP1563 mammalian:blasticidin
7 HsCD00039645 Plasmid Details cDNA NMNAT3 nicotinamide nucleotide adenylyltransferase 3 NA BC034374 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00042821 Plasmid Details cDNA NMNAT3 nicotinamide nucleotide adenylyltransferase 3 NA BC034374 No/No CLOSED pDONR221 bacterial:kanamycin
9 HsCD00287952 Plasmid Details cDNA NMNAT2 nicotinamide nucleotide adenylyltransferase 2 NA BC020998.2 No/No FUSION pENTR223 bacterial:spectinomycin
10 HsCD00288084 Plasmid Details cDNA NAMPT nicotinamide phosphoribosyltransferase NA BC072439.1 No/No FUSION pENTR223 bacterial:spectinomycin
11 HsCD00301057 Plasmid Details cDNA NADK NAD kinase NA AK023114 No/Yes FUSION pLDNT7_nFLAG bacterial:ampicillin
12 HsCD00303648 Plasmid Details cDNA NAMPT nicotinamide phosphoribosyltransferase NA BC072439.1 No/No FUSION pANT7_cGST bacterial:ampicillin
13 HsCD00352530 Plasmid Details cDNA NAMPT nicotinamide phosphoribosyltransferase NA HQ447548 No/No FUSION pDONR223 bacterial:spectinomycin
14 HsCD00353283 Plasmid Details cDNA NMNAT2 nicotinamide nucleotide adenylyltransferase 2 NA HQ447356 No/No FUSION pDONR223 bacterial:spectinomycin
15 HsCD00356389 Plasmid Details cDNA NAMPT nicotinamide phosphoribosyltransferase NA HQ447548 No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsCD00357048 Plasmid Details cDNA NMNAT2 nicotinamide nucleotide adenylyltransferase 2 NA HQ447356 No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsCD00399665 Plasmid Details cDNA NMNAT1 nicotinamide nucleotide adenylyltransferase 1 NA JF432503 No/No FUSION pDONR223 bacterial:spectinomycin
18 HsCD00404672 Plasmid Details cDNA NMNAT1 nicotinamide nucleotide adenylyltransferase 1 NA JF432503 No/No FUSION pANT7_cGST bacterial:ampicillin
19 HsCD00434577 Plasmid Details cDNA NAPRT1 nicotinate phosphoribosyltransferase domain containing 1 NA No/Yes FUSION pLX304 mammalian:blasticidin
20 HsCD00434593 Plasmid Details cDNA NMNAT1 nicotinamide nucleotide adenylyltransferase 1 NA JF432503 No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00437139 Plasmid Details cDNA NMNAT3 nicotinamide nucleotide adenylyltransferase 3 NA DQ893959 No/No FUSION pLX304 mammalian:blasticidin
22 HsCD00439400 Plasmid Details cDNA NAPRT1 nicotinate phosphoribosyltransferase domain containing 1 NA No/No FUSION pLX304 mammalian:blasticidin
23 HsCD00441112 Plasmid Details cDNA QPRT quinolinate phosphoribosyltransferase NA No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00442891 Plasmid Details cDNA NAMPT nicotinamide phosphoribosyltransferase NA HQ447548 No/No FUSION pLX304 mammalian:blasticidin
25 HsCD00444836 Plasmid Details cDNA NMNAT2 nicotinamide nucleotide adenylyltransferase 2 NA HQ447356 No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00507029 Plasmid Details cDNA NMNAT3 nicotinamide nucleotide adenylyltransferase 3 NA DQ893959 No/No FUSION pENTR223 bacterial:spectinomycin
27 HsCD00508701 Plasmid Details cDNA NMNAT1 nicotinamide nucleotide adenylyltransferase 1 NA JF432503 No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00508992 Plasmid Details cDNA QPRT quinolinate phosphoribosyltransferase NA No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00509148 Plasmid Details cDNA NMNAT2 nicotinamide nucleotide adenylyltransferase 2 NA HQ447356 No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00512062 Plasmid Details cDNA NADK NAD kinase NA No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00512477 Plasmid Details cDNA NAPRT1 nicotinate phosphoribosyltransferase domain containing 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
32 HsCD00513837 Plasmid Details cDNA NAMPT nicotinamide phosphoribosyltransferase NA HQ447548 No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00616904 Plasmid Details cDNA QPRT quinolinate phosphoribosyltransferase NA BC005060 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
34 HsCD00629313 Plasmid Details cDNA NADK NAD kinase NA No/No FUSION pANT7_cGST bacterial:ampicillin
35 HsCD00630768 Plasmid Details cDNA QPRT quinolinate phosphoribosyltransferase NA No/No FUSION pANT7_cGST bacterial:ampicillin
36 HsCD00641095 Plasmid Details cDNA NMNAT3 nicotinamide nucleotide adenylyltransferase 3 NA NM_178177 No/No FUSION pANT7_cGST bacterial:ampicillin
37 HsCD00641643 Plasmid Details cDNA NAPRT1 nicotinate phosphoribosyltransferase domain containing 1 NA NM_145201 No/No FUSION pANT7_cGST bacterial:ampicillin
38 HsUT00698689 Plasmid Details 3'UTR PSMD9 proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 Sequence Verified: Yes; 3'UTR length: 1734; Forward Primer: AACATTATTCCTCTGCAAAGATGA; Reverse Primer: TGCAGGAAACCAGCCAGAG NM_002813 No/No NA P2RP3 bacterial:kanamycin
39 HsCD00734380 Plasmid Details cDNA NMNAT2 nicotinamide nucleotide adenylyltransferase 2 NA BC020998 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: