DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Adrenaline signalling through Alpha-2 adrenergic receptor, 8 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00021574 Plasmid Details cDNA ADRA2A adrenergic, alpha-2A-, receptor NA BC050414 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00292908 Plasmid Details cDNA ADRA2A Alpha-2A adrenergic receptor NA NP_000672 No/No CLOSED pJ2 bacterial:kanamycin
3 HsCD00292909 Plasmid Details cDNA ADRA2A adrenergic, alpha-2A-, receptor NA NP_000672 No/No CLOSED pJ2 bacterial:kanamycin
4 HsCD00292910 Plasmid Details cDNA ADRA2A adrenergic, alpha-2A-, receptor NA NP_000672 No/No CLOSED pJ2 bacterial:kanamycin
5 HsCD00300158 Plasmid Details cDNA ADRA2A adrenergic, alpha-2A-, receptor NA BC050414 No/No FUSION pLDNT7_nFLAG bacterial:ampicillin
6 HsCD00515699 Plasmid Details cDNA ADRA2B adrenergic, alpha-2B-, receptor NA No/No FUSION pENTR223 bacterial:spectinomycin
7 HsUT00698893 Plasmid Details 3'UTR HHAT hedgehog acyltransferase Sequence Verified: Yes; 3'UTR length: 2097; Forward Primer: GACCTACGCCACGGACTA; Reverse Primer: GCACCACCATTCAGAGTAACTACAAGATTT NM_001122834 No/No NA P2RP3 bacterial:kanamycin
8 HsCD00731745 Plasmid Details cDNA ADRA2B adrenoceptor alpha 2B NA NM_000682 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: