DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : O-antigen biosynthesis, 12 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00003130 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA BC000012 No/No CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00003131 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA BC000012 No/No CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00041121 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA BC000012 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00044239 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA BC000012 No/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00399808 Plasmid Details cDNA TGDS TDP-glucose 4,6-dehydratase NA JF432660 No/No FUSION pDONR223 bacterial:spectinomycin
6 HsCD00404710 Plasmid Details cDNA TGDS TDP-glucose 4,6-dehydratase NA JF432660 No/No FUSION pANT7_cGST bacterial:ampicillin
7 HsCD00441807 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA DQ895371 No/No FUSION pLX304 mammalian:blasticidin
8 HsCD00444889 Plasmid Details cDNA TGDS TDP-glucose 4,6-dehydratase NA JF432660 No/No FUSION pLX304 mammalian:blasticidin
9 HsCD00510276 Plasmid Details cDNA TGDS TDP-glucose 4,6-dehydratase NA JF432660 No/No FUSION pENTR223 bacterial:spectinomycin
10 HsCD00514451 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA DQ895371 No/No FUSION pENTR223 bacterial:spectinomycin
11 HsUT00697992 Plasmid Details 3'UTR UBE2B ubiquitin-conjugating enzyme E2B Sequence Verified: Yes; 3'UTR length: 1935; Forward Primer: ATTGTTGAACAAAGCTGGAATGATTCATAA; Reverse Primer: TTTAAACTGGGAAAGGCAAAAACAGGTC NM_003337 No/No NA P2RP3 bacterial:kanamycin
12 HsCD00731397 Plasmid Details cDNA GFPT2 glutamine-fructose-6-phosphate transaminase 2 NA BC000012 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: